The complete chloroplast DNA sequence of eleven grape cultivars. simultaneous resequencing methodology
Abstract
Aims: The chloroplast DNA sequence of eight Georgian grape cultivars (Rkatsiteli, Saperavi, Meskhuri Mtsvane, Chkhaveri, Aladasturi, Krakhuna, Tsitska, Tsolikouri) and three French cultivars (Chardonnay, Gouais Blanc, Chasselas), belonging to four different haplogroups (AAA, ATT, ATA, GTA), was determined by Illumina resequencing of genomic DNA. The chloroplast DNA sequence of the Maxxa cultivar was used as reference.
Methods and results: The comparison of sequenced chloroplast DNA gave 100 % identity to Chardonnay and Gouais Blanc, differing from Meskhuri Mtsvane by two insertions/deletions (indels) (all ATA haplogroup). The difference between Chasselas and Saperavi was a single insertion (both ATT haplogroup), while Maxxa, Chkhaveri, Aladasturi, Krakhuna, Tsitska and Tsolikouri were all identical (all members of the GTA haplogroup). Forty-seven identical single nucleotide polymorphisms (SNPs) were detected in the AAA, ATA and ATT haplogroups in comparison to the reference DNA. Additionally, 18 SNPs were detected for the ATT haplogroup, 4 for AAA, 6 for ATA and 11 for both AAA and ATA. The phylogenetic results show that the ATT, AAA and ATA haplogroups are more closely related to each other than to the GTA haplogroup.
Conclusion: In the sequencing data of grape genomic DNA at the coverage (read depth) of chromosomal DNA 30-40, the coverage of chloroplast DNA reaches several thousand reads per bp due to the high number of chloroplast DNA copies in genomic DNA, much higher than necessary for resequencing. Based on these data, a new methodology of simultaneous resequencing of large number of chloroplast DNA was developed without preliminary chloroplast isolation or chloroplast enrichment.
Significance and impact of the study: This method has great potential for expanding both phylogenetic and population genetic information on the evolution of domesticated crops.
Introduction
Georgia is home to over 500 grape cultivars (Ketskhoveli et al. 1960). The greater Caucasus region in which Georgia lies is widely believed to be the area where grape domestication began, and the study of genetic diversity in this region is viewed as a key to understanding grape domestication in general (Negrul 1946).
The plastid genome is an effective tool for interspecific phylogenetic and intraspecific phylogeographic studies of angiosperms (Aoki et al. 2006; Gutiérrez-Rodríguez et al. 2011). Few papers are devoted to grape chloroplast DNA. Arroyo-Garcia et al. (2006) analyzed chloroplast DNA variation at nine polymorphic microsatellite loci of 1201 V. vinifera genotypes belonging to both sativa and sylvestris subspecies. Genotypic analyses for these microsatellite loci identified eight different chlorotypes (A to H) (Arroyo-Garcia et al. 2006). Among them, only four (A, B, C and D) had global frequencies greater than 5%. The intermediate relationship of chlorotype B to all other chlorotypes suggests that it could be an ancestral V. vinifera chlorotype.
Plastid DNA of Caucasian (Georgian) grape varieties was studied by sequencing of some noncoding regions of grape chloroplast DNA (Beridze et al. 2011). During the investigation of 113 samples of a world-wide set of grape cultivars including Georgian cultivars, four plastid DNA haplotypes were evident and were designated by their character-states at each of the three polymorphic positions (Beridze et al. 2011) (Table 1).
Table 1. Haplogroup definition for investigated cultivars.
| Haplogroup | Nucleotide position | Investigated cultivars | ||
| 205 | 86715 | 86721 | ||
| AAA (1 haplotype) | A | A | A | Rkatsiteli |
| ATA (2 haplotypes) | A | T | A | Chardonnay, Gouais Blanc, Meskhuri Mtsvane |
| ATT (2 haplotypes) | A | T | T | Chasselas, Saperavi |
| GTA (1 haplotype) | G | T | A | Pinot Noir, Maxxa, Chkhaveri, Aladasturi, Krakhuna, Titska, Tsolikuri |
The AAA plastid haplotype was found only in the cultivars from Georgia. More specifically, twenty-three (57.5%) of the 40 included Georgian cultivars exhibited this haplotype, of which the “Rkatsiteli” cultivars originating from Eastern Georgia prevailed. This contrasts with the nine cultivars (22.5%) of the “Chkhaveri” group (GTA), which are mostly cultivated in Western Georgia near the Black Sea coast. Six other Georgian cultivars exhibited the “Saperavi” (ATT) haplotype. Among these was the well-known Saperavi cultivar, which is now mainly distributed in Eastern Georgia but is believed to have originated in south-west Caucasus. Only two Georgian cultivars exhibited the “Meskhuri” group haplotype (ATA), as this group comprises mainly West European cultivars (Beridze et al. 2011). Both the B and C chlorotypes of Arroyo-Garcia et al. (Arroyo-Garcia et al. 2006) are combined in the haplotype ATA according to these data (Beridze et al. 2011).
The genomic DNA of Georgian grape cultivars was also studied by nuclear microsatellite analysis based on 20 nuclear microsatellites and no close relationship between Georgian and Western European cultivars was found (Imazio et al. 2013).
In the present investigation, the whole chloroplast DNA of four Georgian grape cultivars, one from each haplotype group (as defined by (Beridze et al. 2011)), was sequenced. These cultivars were: Rkatsiteli (haplotype AAA), Saperavi (haplotype ATT), Meskhuri Mtsvane (haplotype ATA) and Chkhaveri (haplotype GTA).
In the sequencing data of the four Georgian grape cultivars (coverage of chromosomal DNA 30-40), the coverage of chloroplast DNA reaches several thousand because of the high number of chloroplast DNA copies in genomic DNA, much higher than necessary for resequencing. The idea of the new methodology of simultaneous sequencing of large number of chloroplast DNA was developed by mixing and sequencing the genomic DNA from many cultivars in one Illumina lane upon individually barcoding each library without preliminary chloroplast isolation or chloroplast enrichment. The chloroplast DNA of ten different grape cultivars and species was sequenced simultaneously in one Illumina run. As a result, the number of sequenced chloroplast DNA of grape cultivars increased to eleven: to the four Georgian grape cultivars mentioned above, seven others, three French - Chardonnay, Gouais Blanc (both ATA haplogroup) and Chasselas (ATT haplogroup) - and four Georgian cultivars - Aladasturi, Krakhuna, Tsitska and Tsolikouri (all GTA haplogroup) - were added.
Materials and methods
1. Plant material and DNA isolation
The grape cuttings of four grape cultivars (Rkatsiteli, Saperavi, Meskhuri Mtsvane and Chkhaveri) were collected at the Saguramo National Centre for Grapevine and Fruit Tree Planting Material Propagation (Mtskheta, Georgia) and grown in water at room temperature. Total genomic DNA was extracted from young grape leaves. The leaves were ground in liquid nitrogen and DNA was isolated using the CTAB-based method (Lodhi et al. 1994). All four DNA preparations were preliminarily checked by sequencing of three noncoding plastid DNA regions (the trnH-psbA intergenic spacer, the accD-psaI intergenic spacer and the rpl16 intron).
The DNA of other grape cultivars (Muscat Blanc à Petits Grains, Chardonnay, Cabernet Sauvignon, Cabernet Franc, Veltliner Rot, Mourvedre, Alvarelhao, Traminer Rot, Gouais Blanc, Chasselas, Aladasturi, Krakhuna, Tsitska, Tsolikouri) was also analyzed. The origin of these cultivars (total of 59 cuttings received from the Institut National de la Recherche Agronomique (INRA), Montpellier, France) and DNA isolation procedure have been described in our previous publication (Beridze et al. 2011).
2. PCR conditions and Sanger sequencing
The PCR conditions included initial denaturing at 94 °C for 1 min, 30 cycles of 94 °C denaturing (1 min), 55 °C annealing (1 min) and 72 °C extension (2 min), followed by a final extension step at 72 °C (5 min). Sigma-Aldrich chemicals were used for the PCR reactions. PCR products were purified with GenElute PCR Clean-Up Kit (Sigma-Aldrich), dye-labeled using a Big Dye Terminator Kit (Applied Biosystems) and analyzed on either an Applied Biosystems 3100 or 3700 genetic analyzer (Laboratory Services Division of the University of Guelph, ON, Canada). Sequences were manually aligned in Se-Al (Rambaut 2002) and haplotype networks were generated using TCS1.18 (Clement et al. 2000).
3. Construction of shotgun genomic DNA libraries
Shotgun genomic DNA libraries were constructed using the TruSeq DNA Sample prep kit (Illumina, San Diego, CA). Briefly, 1mg of genomic DNA was sonicated on a Bioruptor (Diagenode, NJ) for 20 cycles of 30 sec ON and 90 sec OFF. After sonication, DNA was blunt-ended, 3'-end A-tailed and ligated to indexed adaptors. The adaptor-ligated DNA was size selected with AMPure-beads using the gel-free protocol described in the TruSeq DNA Sample Prep manual. Size-selected DNA was amplified by PCR to selectively enrich for those fragments that have adapters on both ends. Amplification was carried out for 6 cycles with the Kapa HiFi polymerase (Kapa Biosystems, Woburn, MA) to reduce the likeliness of multiple identical reads due to preferential amplification. The final libraries were quantitated by quantitative qPCR on an ABI 7900 (Life Technologies, Grand Island, NY). Final amplified libraries were also run on Agilent bioanalyzer DNA 7500 LabChips (Agilent, Santa Clara, CA) to determine the average fragment size and to confirm the presence of DNA of the expected size range.
4. Sequencing on an Illumina HiSeq 2000
The libraries were pooled in equimolar concentration and loaded onto one lane of an 8-lane flow cell for cluster formation and sequenced on an Illumina HiSeq 2000. The libraries were sequenced from both ends of the molecules to a total read length of 100 nt from each end. The raw bcl files were converted into demultiplexed compressed fastq files using Casava 1.8.2 (Illumina).
The sequencing of Saperavi, Meskhuri Mtsvane and Chkhaveri DNA was carried out at the facilities of Roy J. Carver Biotechnology Center, University of Illinois in Urbana-Champaign (USA); Rkatsiteli DNA was sequenced at the Laboratory Services Division of Guelph University (Canada). For the assembly of Georgian grape cultivar genome, the Maxxa plastid DNA sequence was used (http://www.ncbi.nlm.nih.gov/nuccore/91983971) (Jansen et al. 2006). Some disputed regions of chloroplast DNAs were additionally sequenced by capillary sequencing (Table 2).
Table 2. Regions sequenced by capillary electrophoresis.
| Primers | Forward | Reverse |
|
Primer1: 54 bp deletion (position 30,133 – 30,186) (haplotypes - AAA, ATA, ATT) |
CTACTGGCCCGGTCTTGAAT | TGGAATCGATGGTGCAGAGT |
|
Primer 2: 54 bp deletion (position 30,133 – 30,186) (haplotypes - AAA, ATA, ATT) |
GGGTGTCGCCTGATCAACAA | TTAAAGCAGCCCAAGCGAGA |
|
Primer 3: 33 bp duplication (position 6,658 - 6,691) (haplotypes AAA, ATA, ATT) |
TCAAGTCGCACGTTGCTTTC | GATGTAATGATGTCGAAGTAGTCAA |
|
Primer 4: 18 bp insertion (position 10,001 - 10,019) (haplotype ATT) |
TTATTCCCACGGCCCGGATA | TTGTGCAAGAATCCATAGTTCCC |
|
Primer 5: 18 bp duplication (position 19,527-19,544) (haplotype AAA) |
GGCTGTTCCTAAAGGACCCAA | TCGAAAAGACCCATGCTTCC |
5. Computational analysis
Raw FASTAQ data files were used to align paired-end reads to the Maxxa chloroplast reference genome using Bowtie 2 (version 2.1.0) (Langmead et al. 2012) using default alignment criteria, in particular:
- Reads with more than 15 ambiguous characters (Ns and .s) were filtered out.
- Reads with gaps within 4 positions of read ends were disallowed.
Traditionally, variant calling programs are geared towards nuclear DNA of diploid organisms and relatively low read coverage. In case of chloroplasts, however, there is a multitude of DNA molecules per chloroplast as well as a multitude of chloroplasts per cell. This results, on one hand, in a very high coverage of chloroplast DNA (taken as one) during HiSeq sequencing and, on the other hand, in the possibility of heteroplasmy (presence of multiple chloroplast genomes within a cell). Because of this, we used a somewhat different approach in identifying single nucleotide polymorphisms (SNPs) and insertions/deletions (indels).
All of aligned reads allowed by Bowtie 2 were considered and weighted equally. This information was extracted into mpileup files using SAMtools (Li et al. 2009a). The very high coverage (ranging from 8,000 to 20,000 reads per bp) gave us the flexibility of using even lower quality reads, relying on the law of large numbers to make variant calls for high-level mutations while also detecting potential lower-level mutations. To verify this approach computationally, we also applied a more traditional computational pipeline to variant calling (filtering on read qualities and applying various variant calling programs with consequent realignments) to obtain near-identical results. In addition, looking at total read counts allowed us to easily identify a large 54-bp deletion in three out of four cultivars (see Fig. 1). The filtered chloroplast reads were assembled in parallel by SOAPdenovo computer program and coinciding results were received (Li et al. 2009b).

Figure 1. Read counts (depth coverage) for the alignment of Meskhuri Mtsvane cultivar chloroplast DNA. The reads of Meskhuri Mtsvane were aligned against the reference genome of Maxxa chloroplast. The graph shows the depth coverage for each position of the reference sequences after initial alignment performed by Bowtie 2. The dip at around 30,000 bp corresponds to a 54-bp deletion in Meskhuri Mtsvane chloroplast genome.
The chloroplast DNA sequences of the Georgian grape cultivars have been deposited in the DNA Data Bank of Japan. Accession numbers: AB856289 Rkatsiteli; AB856290 Saperavi; and AB856291 Meskhuri Mtsvane.
Results
We identified 86 SNPs in three Georgian grape cultivars in comparison to the reference Maxxa chloroplast DNA (Table 3). Forty-seven identical SNPs were characteristic for all three cultivars (Rkatsiteli + Saperavi + Meskhuri Mtsvane), the additional SNPs were: 18 for Saperavi, 4 for Rkatsiteli, 6 for Meskhuri Mtsvane and 11 for both Rkatsiteli and Meskhuri Mtsvane. The number of noncoding substitutions was 67 and coding substitutions 19. In 8 cases, nonsynonymous substitutions were observed, which altered the amino acid sequence (Table 3). In 13 cases, synonymous substitutions were detected. In gene ycf1, 5 SNPs (3 nonsynonymous and 2 synonymous) were observed.
Table 3. The intravarietal SNPs and amino acid substitutions in Georgian grape chloroplast DNA.
| Nucleotide Position | Locus | Saperavi | Rkatsiteli | Meskhuri Mtsvane | Amino Acid Substitutions |
| 205 | Intergenic trnH-psbA | G-A | G-A | G-A | |
| 1552 | Intergenic psbA - trnK-UUU | G-A | |||
| 4527 | Intergenic trnK-UUU - rps16 | T-G | |||
| 4547 | Intergenic trnK-UUU - rps16 | A-T | |||
| 5591 | Intron rps16 | A-C | |||
| 5978 | Intron rps16 | T-G | T-G | ||
| 8114 | Intergenic rps16 - trnQ-UUG | A-G | A-G | A-G | |
| 8175 | Intergenic rps16 - trnQ-UUG | T-C | T-C | T-C | |
| 9996 | Intergenic trnS-GCU - trnG-GCC | A-G | A-G | A-G | |
| 10266 | Intergenic trnS-GCU - trnG-GCC | A-T | |||
| 11120 | Intron trnG-GCC | A-G | A-G | ||
| 11121 | Intron trnG-GCC | A-T | |||
| 11625 | Intergenic trnR-UCU - atpA | T-A | T-A | T-A | |
| 14416 | Intron gene atpF | A-G | A-G | A-G | |
| 14794 | Intergenic atpF - atpH | T-A | T-A | T-A | |
| 20840 | Gene rpoC2 | C-T | C-T | C-T | S - N |
| 21046 | Gene rpoC2 | G-T | G-T | G-T | F - L |
| 22321 | Gene rpoC2 | A-G | A-G | A-G | syn |
| 24437 | Intron rpoC1 | C-A | C-A | C-A | |
| 28707 | Intergenic rpoB - trnC-GCA | T-G | |||
| 29232 | Intergenic rpoB - trnC-GCA | T-C | |||
| 29507 | Intergenic rpoB - trnC-GCA | C-T | C-T | C-T | |
| 29571 | Intergenic rpoB - trnC-GCA | G-T | G-T | G-T | |
| 30783 | Intergenic petN - psbM | T-C | T-C | T-C | |
| 32670 | Intergenic psbM - trnD-GUC | C-G | C-G | C-G | |
| 34037 | Intergenic trnE-UUC - trnT-GGU | C-A | C-A | C-A | |
| 36031 | Intergenic trnT-GGU - gene psbD | C-A | |||
| 36397 | Gene psbD | A-C | A-C | A-C | syn |
| 39357 | Gene psbZ | T-A | T-A | T-A | syn |
| 39584 | Intergenic psbZ - trnG-GCC | T-G | T-G | T-G | |
| 39585 | Intergenic psbZ - trnG-GCC | C-G | C-G | C-G | |
| 39586 | Intergenic psbZ - trnG-GCC | C-A | C-A | C-A | |
| 39883 | Intergenic psbZ - trnG-GCC | T-A | T-A | T-A | |
| 39885 | Intergenic psbZ - trnG-GCC | C-T | C-T | C-T | |
| 39961 | Intergenic psbZ - trnG-GCC | T-G | T-G | T-G | |
| 42474 | Gene psaB | C-T | C-T | C-T | G - S |
| 43685 | Gene psaA | T-G | syn | ||
| 43910 | Gene psaA | C-G | syn | ||
| 50339 | Intergenic trnT-UGU - trnL-UAA | T-G | |||
| 50627 | Intergenic trnT-UGU - trnLUAA | T-A | T-A | T-A | |
| 51700 | Gene trnL-UAA | A-T | |||
| 54999 | Intergenic ndh3 - trnV-UAC | T-G | T-G | ||
| 55094 | Intergenic ndh3 - trnV-UAC | T-C | T-C | T-C | |
| 59143 | Intergenic atpB - rbcL | A-T | |||
| 61186 | Intergenic rbcL - accD | T-G | T-G | T-G | |
| 63186 | Intergenic accD - psaI | C-T | C-T | C-T | |
| 63478 | Intergenic accD - psaI | T-A | T-A | T-A | |
| 63819 | Gene psaI | A-G | A-G | A-G | syn |
| 67651 | Intergenic petA - psbJ | T-C | T-C | T-C | |
| 70248 | Intergenic psbE - petL | A-C | A-C | ||
| 70595 | Intergenic psbE - petL | C-T | C-T | C-T | |
| 70921 | Intergenic petL - petG | G-A | G-A | ||
| 71588 | Intergenic trnP-UGG - psaJ | C-T | C-T | C-T | |
| 73579 | Gene rpl20 | C-T | syn | ||
| 73765 | Gene rpl20 | G-A | syn | ||
| 75398 | Intron clpP | C-T | |||
| 77099 | Intergenic clpP - psbB | C-T | C-T | C-T | |
| 80022 | Intron petB | A-C | A-C | A-C | |
| 80194 | Intron petB | C-T | |||
| 80276 | Intron petB | C-T | C-T | C-T | |
| 86715 | Intron rpl16 | T-A | |||
| 86721 | Intron rpl16 | A-T | |||
| 89112 | Gene rps19 | C-T | syn | ||
| 99217 | Intergenic ycf2 - trnL-CAA | A-T | A-T | ||
| 99218 | Intergenic ycf2 - trnL-CAA | T-G | T-G | ||
| 99219 | Intergenic ycf2 - trnL-CAA | C-A | C-A | ||
| 99220 | Intergenic ycf2 - trnL-CAA | A-T | A-T | ||
| 115531 | Intergenic ycf1 - ndhF | A-T | |||
| 117310 | Gene ndhF | T-G | T-G | T-G | syn |
| 117791 | Intergenic ndhF - rpl32 | T-A | T-A | T-A | |
| 119481 | Intergenic rpl32 - trnL-UAG | G-T | G-T | G-T | |
| 119571 | Intergenic rpl32 - trnL-UAG | T-G | T-G | T-G | |
| 121732 | Intergenic ycf5 - ndhD | A-C | A-C | A-C | |
| 123321 | Intergenic ndh4 - psaC | A-T | A-T | A-T | |
| 123367 | Intergenic ndhD - psaC | T-A | |||
| 123664 | Intergenic psaC - ndhE | T-G | T-G | ||
| 123690 | Intergenic psaC - ndhE | C-A | |||
| 124258 | Intergenic ndhE - ndhG | G-A | G-A | G-A | |
| 125681 | Gene ndhI | G-A | G-A | G-A | syn |
| 126020 | Gene ndhA | G-T | L - M | ||
| 128420 | Gene ndhH | C-T | E - K | ||
| 131820 | Gene ycf1 | T-C | T-C | T-C | Q - R |
| 133211 | Gene ycf1 | T-G | T-G | syn | |
| 133359 | Gene ycf1 | A-C | L - W | ||
| 133934 | Gene ycf1 | G-T | G-T | G-T | syn |
| 133982 | Gene ycf1 | A-C | I - M |
Short indels were also detected: in Saperavi - 11 insertions and 15 deletions; in Rkatsiteli - 15 insertions and 9 deletions; and in Meskhuri Mtsvane - 13 insertions and 9 deletions. In Chkhaveri, no insertions or deletions were detected in comparison to reference DNA. As a result, the length of sequenced chloroplast DNA varied, with Rkatsiteli at 160,927, Saperavi at 160,928 and Meskhuri Mtsvane at 160,906 bp in length.
In the region surrounding position 30,100 - 30,200 bp, a drastic fall of read numbers was observed in all cultivars except Chkhaveri (Fig. 1). This region was subsequently sequenced by capillary electrophoresis. A 54-bp deletion at position 30,133 - 30,186 (trnC-GCA – petN intergenic spacer) was detected in Saperavi, Rkatsiteli and Meskhuri Mtsvane, but not in Chkhaveri. The existence of this deletion was checked in other grape cultivars including West Europeans. It was established that this 54-bp deletion is typical for all checked AAA, ATA and ATT haplogroups of the world-wide set of grape cultivars, but not for GTA haplogroup (Fig. 2).

Figure 2. 1% agarose gel electrophoresis of PCR-amplified grape chloroplast DNA fragment 29,945 - 30,506. Lanes: 2. Muscat Blanc à Petits Grains (ATT); 3. Chardonnay (ATA); 4. Cabernet Sauvignon (ATT); 5. Cabernet Franc (ATT); 6. Veltliner Rot (ATT); 7. Mourvedre (GTA); 8. Alvarelhao (GTA); 9. Traminer Rot (ATT); and 10. Chkhaveri (GTA). Lanes 1 and 11, 100-bp DNA marker.
Additionally, three other long indels were detected by capillary sequencing in chloroplast DNA (Table 4). Two were in intergenic spacers (Rps16 – trnQ-UUG and trnS-GCU – trnG-GCC); the other was an 18-bp duplication in the rpoC2 gene of Rkatsiteli (AAA haplotype; position 19,527 - 19,544). As a result, a 6-aa-long peptide duplication occurred (TLLNRN; position 934 - 939 in the rpoC2 protein).
Table 4. Long indels in grape chloroplast DNA.
| Nucleotide position | Locus | Haplogroup | Indellength | Indeltype |
| 6,658-6,691 | Rps16 – trnQ-UUG intergenic spacer | AAA, ATA, ATT | 33 bp | Duplication |
| 10,001-10,019 | trnS-GCU – trnG-GCC intergenic spacer | ATT | 18 bp | Duplication |
| 30,133 - 30,186 | trnC-GCA –petN intergenic spacer | AAA, ATA, ATT | 54 bp | Deletion |
| 19,527-19,544 | rpoC2 gene | AAA | 18 bp (6 aminoacid) | Duplication |
To illustrate the evolutionary relationship between the studied cultivars, a phylogenetic tree based on the multiple alignments was constructed using NCBI BLAST’s TreeView Display option that constructs a phylogenetic distance tree based on fast minimum evolution approach (Desper et al. 2002). Figure 3 represents the resulting phylogenetic tree.

Figure 3. Complete chloroplast genome phylogeny of grape cultivars. The GenBank accessions used for the analyses are NC_007957.1 (Maxxa), Chkhaveri, Rkatsiteli, Saperavi, and Meskhuri Mtsvane.
Chloroplast isolation or chloroplast enrichment from leaves of grape cultivars or Vitis species is a great problem due to the large amount of phenolic compounds present in leaves, which negatively influence DNA isolation. Therefore, a method for determining chloroplast DNA sequence directly from genomic DNA was developed.
In sequencing data, the number of reads for chloroplast DNA can, in some cases, reach 20,000 per base due to a high number of chloroplast DNA copies in genomic DNA, whereas for resequencing of DNA, 40-50 reads are sufficient. On the basis of these facts, the new methodology of chloroplast DNA resequencing was developed. The idea was mixing the genomic DNA from many cultivars and sequencing them in one Illumina lane, barcoding each library so that reads coming from each cultivar can be identified. The number of chloroplast DNA reads is quite high, sufficient to compute chloroplast DNA sequence, but reads from chromosomal are low and are ignored.
During manuscript preparation, other papers appeared where next-generation sequencing techniques also have allowed for simultaneous genomic studies of mitochondrial and chloroplast DNA (Hancock-Hanser et al. 2013; Middleton et al. 2014). Here, ten chloroplast DNAs of different grape cultivars (Chardonnay, Gouais Blanc, Chasselas, Aladasturi, Krakhuna, Tsolikouri, Tsitska and Rkatsiteli (as a control)) and species (V. champinii and V. rupestris (not presented in this article)) were sequenced simultaneously in one Illumina lane. Preliminary results show that, together with chloroplast DNA, grape mitochondrial DNA sequences of 10 samples can be computed. In average, the number of reads per base for each chloroplast DNA sample varied between 1000 - 2000. Therefore, it is possible to increase the amount of sequenced chloroplast DNA by 2-3 times based on the fact that for determination of chloroplast DNA sequence, 50-100 reads are sufficient.
The comparison of sequenced chloroplast DNA gave 100% identity to Chardonnay and Gouais Blanc, differing from Meskhuri Mtsvane by 1-bp insertion (position 5415) and 1-bp deletion (position 121,616) (all ATA); the difference between Chasselas and Saperavi was a 1-bp insertion (position 39554) (both ATT); Maxxa, Chkhaveri, Aladasturi, Krakhuna, Tsitska and Tsolikouri (all GTA) gave 100% identity.
Discussion
To date, a sequence of chloroplast DNA is available for only one grape cultivar, V. vinifera L. cv Maxxa (Jansen et al. 2006). To that end, a bacterial artificial chromosome (BAC) library of Maxxa genomic DNA was constructed, BAC clones containing the chloroplast genome inserts were isolated, and the nucleotide sequences of the BAC clones were determined by the shotgun method (Jansen et al. 2006).
During the determination of a high quality draft genome sequence of a cultivated clone of V. vinifera L. cv Pinot Noir, Velasco et al. showed that the chloroplast DNA sequence of Pinot Noir was identical (without a single mismatch) to that of Maxxa (Velasco et al. 2007).
The most interesting result of the present study is that the chloroplast DNA sequence of Georgian grape cultivars is practically identical to that of West European cultivars: the chloroplast DNA of Chkhaveri and four other Georgian cultivars (Aladasturi, Krakhuna, Tsitska, Tsolikouri) is identical (also without a single mismatch) to the reference Maxxa and consequently to Pinot Noir chloroplast DNA. Saperavi and Chasselas chloroplast DNA differ by one insertion. Meskhuri Mtsvane chloroplast DNA differs by two indels from Chardonnay and Gouais Blanc chloroplast DNA. In general, it can be proposed that all GTA, ATA and ATT haplotypes contain practically identical chloroplast DNA. The single haplotype AAA, to which more than half of the analyzed Georgian cultivars belong, had no analogs in the world-wide set of grape cultivars until now (Beridze et al. 2011).
One of the differences between the four haplotypes of grape cultivars, besides SNPs, is a 54-bp deletion in the trnC-GCA ‒ petN intergenic spacer (position 30,133 - 30,186), which is observed in AAA, ATA and ATT haplotypes and absent in GTA haplotype. Additionally, AAA, ATA and ATT haplotypes show a 33-bp duplication in the Rps16 – trnQ-UUG intergenic spacer (position 6,658 - 6,691). In ATT haplotype, an 18-bp duplication in the trnS-GCU – trnG-GCC intergenic spacer (position 10,001 - 10,019) was detected.
The second substantial difference between the studied grape cultivars is the presence of an 18-bp duplication (TATTTCTATTTAATAACG; position 19,527 - 19,544; rpoC2 gene) in Rkatsiteli (AAA haplotype) chloroplast DNA. As a result, a 6-aa-long peptide (TLLNRN; position 934 - 939 in the rpoC2 protein) duplication is observed.
The phylogenetic scheme based on indel priority of grape chloroplast DNA haplotypes is presented (Fig. 4). Comparative analysis shows that the separation of Chkhaveri (GTA haplotype) and three other cultivars (AAA, ATA, ATT haplotypes) occurred by a 33-bp duplication and a 54-bp deletion in AAA, ATA, ATT haplotypes (no other Vitis species show this 54-bp deletion). Further separation occurred between ATT and the two haplotypes ATA and AAA by an 18-bp duplication and between ATA and AAA again by an 18-bp duplication.

Figure 4. The phylogenetic scheme based on single nucleotide polymorphisms (SNP) and insertions/deletions (indel) priority of grape chloroplast DNA haplogroups.
8 of 11 grape chloroplast DNAs were sequenced by the new methodology of simultaneous resequencing. This methodology can be used also for determination of mitochondrial DNA sequences. It has great potential for expanding both phylogenetic and population genetic information on the evolution of domesticated crops.
Myles et al. find support for a Near East origin of vinifera and present evidence of introgression from local sylvestris as grapes moved into Europe (Myles et al. 2011). But exact DNA data of grape domestication is still absent. The sequencing of wild samples can shed light on grape domestication. Arroyo-Garcia et al. suggested the existence of at least two origins for grape cultivars, one in the Near East characterized by chlorotypes C (ATA haplotype in the present publication) and D (ATT haplotype) and a western one related to Iberian Peninsula cultivars and characterized by chlorotype A (GTA haplotype) (Arroyo-Garcia et al. 2006). The geographic distribution observed for some chlorotypes in sylvestris groups is still observed in cultivated groups. Cultivars with chlorotype A are highly abundant in Western Europe while they are not observed in the Near and Middle East samples. Similarly, chlorotypes C and D, which are very common among the Near East and Middle East cultivars, are less frequent among Iberian Peninsula cultivars.
Unfortunately the cultivars from South Caucasus were not analyzed in this investigation, though the role of South Caucasus in grape domestication was underlined. Later DNA sequence diversity was investigated in a group of 40 wild grape (Vitis vinifera subsp. sylvestris) samples from the South Caucasus at four plastid regions (accD-psaI intergenic spacer was added; 63,186 - T, C). This group included 22 samples from Georgia, 9 samples from Azerbaijan, 2 samples from Armenia and 7 samples from Turkey (the base in the parenthesis corresponds to accD-psaI intergenic spacer) (Pipia et al. 2012).
As in the case of the world-wide set of grape cultivars, four plastid haplotypes were evident in the 40 wild samples: AAA(T) – 22 samples, ATT(T) – 6 samples, GTA(C) – 1 sample, and ATA(T) – 11 samples. The AAA(T) haplotype was restricted to Georgia and Azerbaijan, the ATA(T) haplotype was distributed across the entire study area, the ATT(T) haplotype was distributed in the southern part of the study area from the Black Sea to the Caspian Sea, and the GTA(C) haplotype was only found in southwestern Georgia. The AAA(T) haplotype is restricted to both wild (V. vinifera subsp. sylvestris) and cultivated (V. vinifera subsp. vinifera) grape samples from the Caucasus. The observation that haplotype AAA(T) is found only among Georgian grape cultivars and is restricted to wild samples of Georgia and Azerbaijan suggests that this haplotype was domesticated in South Caucasus. It was proposed that the initial grape dispersal to Greece and Egypt may have occurred not only by land but also by sea, because the AAA(T) haplotype was formed in the Alazani hearth (far from the Black Sea) and this haplotype is absent in the world-wide set of cultivars (Pipia et al. 2012).
As mentioned by Arroyo-Garcia et al. many of the current grape varieties can be traced back hundred and even thousand years based on historical records; they are probably separated from their wild relatives by a low number of sexual generations (Arroyo-Garcia, L. et al. 2006). Regarding grape domestication, currently only one evidence seems credible: AAA haplotype is restricted to both wild and cultivated grape samples in South Caucasus (Pipia et al. 2012). This haplotype seems to have been domesticated in South Caucasus.
Conclusions
To date, a complete sequence of chloroplast DNA has been published for the grape cultivar Maxxa. In the present investigation, the chloroplast DNA sequence of eight Georgian grape cultivars (Rkatsiteli, Saperavi, Meskhuri Mtsvane, Chkhaveri, Aladasturi, Krakhuna, Tsitska, Tsolikouri) and three French cultivars (Chardonnay, Gouais Blanc, Chasselas), belonging to four different haplogroups (AAA, ATT, ATA, GTA), was determined by Illumina resequencing of genomic DNA. A new methodology of simultaneous resequencing of large number of chloroplast DNA was developed without preliminary chloroplast isolation or chloroplast enrichment. This method has great potential for expanding both phylogenetic and population genetic information on the evolution of domesticated crops.
Acknowledgements: The authors would like to thank Mr. K. Bendukidze for permanent interest and support. This research was funded by Knowledge Fund. Knowledge Fund is the funding organization of the Free University of Tbilisi and Agricultural University of Georgia.
References
- Aoki K., Matsumura T., Hattori T. and Murakami N. (2006). Chloroplast DNA phylogeography of Photinia glabra (Rosaceae) in Japan. American Journal of Botany 93(12): 1852-1858. doi:10.3732/ajb.93.12.1852
- Arroyo-Garcia R., Ruiz-Garcia L., Bolling L., Ocete R., Lopez M.A., Arnold C., Ergul A., Söylemezoğlu G., Uzun H.I., Cabello F., Ibanez J., Aradhya M.K., Atanassov A., Atanassov I., Balint S., Cenis J.L., Costantini L., Gorislavets S., Grando M.S., Klein B.Y., McGovern P.E., Merdinoglu D., Pejic I., Pelsy F., Primikirios N., Risovannaya V., Roubelakis-Angelakis K.A., Snoussi H., Sotiri P., Tamhankar S., This P., Troshin L., Malpica J.M., Lefort F. and Martinez-Zapater J.M. (2006). Multiple origins of cultivated grapevine (Vitis vinifera L. ssp. sativa) based on chloroplast DNA polymorphisms. Molecular Ecology 15(12): 3707-3714. doi:10.1111/j.1365-294X.2006.03049.x
- Beridze T., Pipia I., Beck J., Hsu S.-C., Gamkrelidze M., Gogniashvili M., Tabidze V., This P., Bacilieri R., Gotsiridze V., Glonti M. and Schaal B. (2011). Plastid DNA sequence diversity in a worldwide set of grapevine cultivars (Vitis vinifera L. subsp. vinifera). Bulletin of the Georgian National Academy of Sciences 5(N1): 98-103.
- Clement M., Posada D. and Crandall K.A. (2000). TCS: a computer program to estimate gene genealogies. Molecular Ecology 9(10): 1657-1659. doi:10.1046/j.1365-294x.2000.01020.x
- Desper R. and Gascuel O. (2002). Fast and accurate phylogeny reconstruction algorithms based on the minimum-evolution principle. Journal of Computational Biology 9(5): 687-705. doi:10.1089/106652702761034136
- Gutiérrez-Rodríguez C., Ornelas J.F. and Rodríguez-Gómez F. (2011). Chloroplast DNA phylogeography of a distylous shrub (Palicourea padifolia, Rubiaceae) reveals past fragmentation and demographic expansion in Mexican cloud forests. Molecular Phylogenetics and Evolution 61(3): 603-615. doi:10.1016/j.ympev.2011.08.023
- Hancock-Hanser B.L., Frey A., Leslie M.S., Dutton P.H., Archer F.I. and Morin P.A. (2013). Targeted multiplex next-generation sequencing: advances in techniques of mitochondrial and nuclear DNA sequencing for population genomics. Molecular Ecology Resources 13(2): 254-268. doi:10.1111/1755-0998.12059
- Imazio S., Maghradze D., de Lorenzis G., Bacilieri R., Laucou V., This P., Scienza A. and Failla O. (2013). From the cradle of grapevine domestication: molecular overview and description of Georgian grapevine (Vitis vinifera L.) germplasm. Tree Genetics & Genomes 9(3): 641-658. doi:10.1007/s11295-013-0597-9
- Jansen R.K., Kaittanis C., Saski C., Lee S.-B., Tomkins J., Alverson A. and Daniell H. (2006). Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids. BMC Evolutionary Biology 6(1): 32. doi:10.1186/1471-2148-6-32
- Ketskhoveli N., Ramishvili M. and Tabidze D. (1960). Ampelography of Georgia. Metsniereba Publishing House, Tbilisi, Georgia.
- Langmead B. and Salzberg S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nature Methods 9(4): 357-359. doi:10.1038/nmeth.1923
- Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and G.P.D.P. Subgroup (2009a). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25(16): 2078-2079. doi:10.1093/bioinformatics/btp352
- Li R., Yu C., Li Y., Lam T.-W., Yiu S.-M., Kristiansen K. and Wang J. (2009b). SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics 25(15): 1966-1967. doi:10.1093/bioinformatics/btp336
- Lodhi M.A., Ye G.-N., Weeden N.F. and Reisch B.I. (1994). A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Molecular Biology Reporter 12(1): 6-13. doi:10.1007/BF02668658
- Middleton C.P., Senerchia N., Stein N., Akhunov E.D., Keller B., Wicker T. and Kilian B. (2014). Sequencing of chloroplast genomes from wheat, barley, rye and their relatives provides a detailed insight into the evolution of the Triticeae tribe. PLoS One 9(3): e85761. doi:10.1371/journal.pone.0085761
- Myles S., Boyko A.R., Owens C.L., Brown P.J., Grassi F., Aradhya M.K., Prins B., Reynolds A., Chia J.-M., Ware D., Bustamante C.D. and Buckler E.S. (2011). Genetic structure and domestication history of the grape. Proceedings of the National Academy of Sciences of the United States of America 108(9): 3530-3535. doi:10.1073/pnas.1009363108
- Negrul A.M. (1946). Ampelography of USSR. Pishchepromizdat.
- Pipia I., Gogniashvili M., Tabidze V., Beridze T., Gamkrelidze M., Gotsiridze V., Melyan G., Musayev M., Salimov V., Beck J.B. and Schaal B. (2012). Plastid DNA sequence diversity in wild grapevine samples (Vitis vinifera subsp. sylvestris) from the Caucasus region. Vitis 51(3): 119-124.
- Rambaut A. (2002). SE-AL Sequence Alignment Program. Department of Zoology, University of Oxford, UK.
- Velasco R., Zharkikh A., Troggio M., Cartwright D.A., Cestaro A., Pruss D., Pindo M., FitzGerald L.M., Vezzulli S., Reid J., Malacarne G., Iliev D., Coppola G., Wardell B., Micheletti D., Macalma T., Facci M., Mitchell J.T., Perazzolli M., Eldredge G., Gatto P., Oyzerski R., Moretto M., Gutin N., Stefanini M., Chen Y., Segala C., Davenport C., Demattè L., Mraz A., Battilana J., Stormo K., Costa F., Tao Q., Si-Ammour A., Harkins T., Lackey A., Perbost C., Taillon B., Stella A., Solovyev V., Fawcett J.A., Sterck L., Vandepoele K., Grando S.M., Toppo S., Moser C., Lanchbury J., Bogden R., Skolnick M., Sgaramella V., Bhatnagar S.K., Fontana P., Gutin A., Van de Peer Y., Salamini F. and Viola R. (2007). A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS ONE 2(12): e1326. doi:10.1371/journal.pone.0001326

Views: 2094
PDF: 818