High Resolution Melting (HRM) analysis on VviDXS to reveal muscats or non-muscats among autochthonous Greek wine producing grape varieties
Abstract
Muscat flavor in grapes is associated with a substitution of a Single Nucleotide Polymorphism (SNP) located at position 1822 (SNP1822G>T) within the coding sequence of the VviDXS gene. Various methods, including the use of High Resolution Melting (HRM) analysis, have been suggested to discriminate different SNP allelic states including the molecular discrimination of the muscat from the non-muscat grape varieties, thus providing the ability to minimize lengthy grape breeding programs when selecting for grape muscat flavor before the fruit maturity stage. HRM analysis on the SNP1822 was performed on a group of 128 wine producing grape varieties in order to separate the muscat from the non-muscat genotypes before they are used for further breeding activities. This approach could be used either as a single-step prescreening method or in accordance with recently published methodology to elucidate on varietal characterization and authentication as these are important requirements concerning nurseries, growers and winemakers.
Introduction
Wine aroma is the final and combinatorial outcome of many genetic and environmental factors, and represents one of the most important and complex characters that highly contribute to the sensory experience and the market value of the product.
The muscat aroma of many grapevine varieties is due to the occurrence of high levels of terpenoid compounds, such as linalool, nerol, α-terpineol, and geraniol. The 1-deoxy-D-xylulose-5-phospate synthase (VviDXS) gene that converts glyceraldehyde 3-phosphate and pyruvate into 1-deoxy-D-xylulose-5-phosphate (DXP) has recently been identified as a functional molecular marker associated with the occurrence of muscat flavor in grapevine (Battilana et al. 2009). Three alternative methods have been developed allowing for large-scale screening and facilitating prompt germplasm characterization in grapevine breeding based on the occurrence of four functional SNPs (SNP1784T>C, SNP1822G>T, SNP1917A>G, and SNP1922C>T) on the VviDXS gene (Emanuelli et al. 2014).
High-resolution melting analysis (HRM) is a cost-effective and less time-consuming method that could detect polymorphisms even at the single nucleotide level measuring the rate of double-stranded DNA dissociation to single-stranded DNA with increasing temperature. HRM has been performed in the successful identification of plant varieties in other species (Ganopoulos et al. 2013).
Here, we focused on SNP1822G>T, introducing an HRM approach in order to molecularly predict the muscat flavor and also detect hidden muscat potential of wine producing varieties. We suggest that this approach could be used either as a single-step pre-screening method or as an auxiliary method to discriminate the muscat from the non-muscat varieties within the Greek grape germplasm.
Materials and methods
Young leaves from a total of 122 autochthonous wine producing Greek varieties were collected and stored at -80°C until analyzed (Table 1). In addition, samples from 6 international varieties were collected and treated similarly, totaling 128 samples. Genetic material is maintained in three collections: i) the ampelographic collection of the Greek Gene Bank, at the Institute of Plant Breeding and Genetic Resources (GGB) of the Hellenic Agricultural Organization 'Demeter' (hereafter HAO-D) at Thermi (Thessaloniki, Greece), ii) the ampelographic collection of the School of Agriculture of the Aristotle University of Thessaloniki (hereafter AUTh collection) (Merkouropoulos et al. 2015), and iii) the grapevine collection of HAO-D at Ampelouzos (Crete, Greece). All DNA isolations were performed using the NucleoSpin Plant II Kit (Macherey Nagel, Duren, Germany) according to the manufacturer’s instructions.
Table 1. HRM genotyping data relating to the 128 Muscat and non-Muscat grapevine varieties analyzed used in this study.
| No | Accession number | Variety name | Maintained at | Empirically known muscats |
HRM profile SNP1822G>T |
Sequencing confirmation of position 1822 |
| 1 | 1501 | Negoska | HAO-D Thermi | - | Non-muscat | - |
| 2 | 1502 | Roditis | HAO-D Thermi | - | Non-muscat | - |
| 3 | 1503 | Atesa | HAO-D Thermi | - | Non-muscat | - |
| 4 | 1504 | Pamidi | HAO-D Thermi | - | Non-muscat | - |
| 5 | 1505 | Fartsalo | HAO-D Thermi | - | Non-muscat | - |
| 6 | 1506 | Xanthofilero | HAO-D Thermi | - | Non-muscat | - |
| 7 | 1507 | Moschofilero Campa | HAO-D Thermi | - | Non-muscat | - |
| 8 | 1508 | Moschofilero Proskinitari | HAO-D Thermi | - | Non-muscat | - |
| 9 | 1509 | Mavro Kalavritino | HAO-D Thermi | - | Non-muscat | - |
| 10 | 1510 | Zalovitiko | HAO-D Thermi | - | Non-muscat | - |
| 11 | 1511 | Mavrokorakas | HAO-D Thermi | - | Non-muscat | - |
| 12 | 1512 | Koumari | HAO-D Thermi | - | Non-muscat | - |
| 13 | 1513 | Tsampato | HAO-D Thermi | - | Non-muscat | - |
| 14 | 1514 | Proniko | HAO-D Thermi | - | Non-muscat | - |
| 15 | 1515 | Mavro Tragano | HAO-D Thermi | - | Muscat | - |
| 16 | 1516 | Aidani Mavro | HAO-D Thermi | - | Non-muscat | - |
| 17 | 1517 | Piperionos | HAO-D Thermi | - | Non-muscat | - |
| 18 | 1518 | Karapapas | HAO-D Thermi | - | Non-muscat | - |
| 19 | 1519 | Pargino | HAO-D Thermi | - | Non-muscat | - |
| 20 | 1520 | Kahpetsi Ooides | HAO-D Thermi | - | Non-muscat | - |
| 21 | 1521 | Araklinos | HAO-D Thermi | - | Non-muscat | - |
| 22 | 1522 | Tenedio | HAO-D Thermi | - | Non-muscat | - |
| 23 | 1523 | Romeiko | HAO-D Thermi | - | Non-muscat | - |
| 24 | 1524 | Roditis Galanos | HAO-D Thermi | - | Non-muscat | - |
| 25 | 1525 | Mavroudi | HAO-D Thermi | - | Non-muscat | - |
| 26 | 1526 | Moschofilero | HAO-D Thermi | - | Non-muscat | - |
| 27 | 1527 | Koritsanos Mavros | HAO-D Thermi | - | Non-muscat | - |
| 28 | 1528 | Mavro Cyprus | HAO-D Thermi | - | Non-muscat | - |
| 29 | 1529 | Avgoustela | HAO-D Thermi | - | Non-muscat | - |
| 30 | 1530 | Diminitis | HAO-D Thermi | - | Non-muscat | - |
| 31 | 1531 | Chrysostafilo | HAO-D Thermi | - | Non-muscat | - |
| 32 | 1532 | Kokkinovostitsa | HAO-D Thermi | - | Non-muscat | - |
| 33 | 1533 | Filoksenis | HAO-D Thermi | - | Non-muscat | - |
| 34 | 1534 | Limperaki | HAO-D Thermi | - | Non-muscat | - |
| 35 | 1535 | Sikiotis | HAO-D Thermi | - | Non-muscat | - |
| 36 | 1536 | Trinka | HAO-D Thermi | - | Non-muscat | - |
| 37 | 1537 | Pardala | HAO-D Thermi | - | Non-muscat | - |
| 38 | 1538 | Mpoutinou | HAO-D Thermi | - | Non-muscat | - |
| 39 | 1539 | Mesoproimadi | HAO-D Thermi | - | Non-muscat | - |
| 40 | 1540 | Karambraimis | HAO-D Thermi | - | Non-muscat | - |
| 41 | 1541 | Xynogaltso de Kozani | HAO-D Thermi | - | Non-muscat | - |
| 42 | 1542 | Giourikiko | HAO-D Thermi | - | Non-muscat | - |
| 43 | 1543 | Glykopati | HAO-D Thermi | - | Non-muscat | - |
| 44 | 1544 | Violento | HAO-D Thermi | - | Non-muscat | - |
| 45 | 1545 | Skylopnichtis Kokkinos | HAO-D Thermi | - | Non-muscat | - |
| 46 | 1546 | Chondromavro | HAO-D Thermi | - | Non-muscat | - |
| 47 | 1547 | Koutsoupia | HAO-D Thermi | - | Non-muscat | - |
| 48 | 1548 | Athinies | HAO-D Thermi | - | Non-muscat | - |
| 49 | 1549 | Skopelitiko | HAO-D Thermi | - | Non-muscat | - |
| 50 | 1550 | Svarna | HAO-D Thermi | - | Non-muscat | - |
| 51 | 1551 | Flora | HAO-D Thermi | - | Non-muscat | - |
| 52 | 1552 | Chouchouliatis | HAO-D Thermi | - | Non-muscat | - |
| 53 | 1553 | Arkoudocheria | HAO-D Thermi | - | Non-muscat | - |
| 54 | 1554 | Mpiritsia | HAO-D Thermi | - | Non-muscat | - |
| 55 | 1555 | Moschato Alexandrias | HAO-D Thermi | √ | Muscat | - |
| 56 | 1556 | Robola Aspri | HAO-D Thermi | - | Muscat | - |
| 57 | 1557 | Askathari | HAO-D Thermi | - | Non-muscat | - |
| 58 | 1558 | Keserlidiko | HAO-D Thermi | - | Non-muscat | - |
| 59 | 1559 | Priknadi | HAO-D Thermi | - | Non-muscat | - |
| 60 | 1560 | Thrapsathiri | HAO-D Thermi | - | Non-muscat | - |
| 61 | 1561 | Vidiano | HAO-D Thermi | - | Non-muscat | - |
| 62 | 1562 | Doumbrena Aspri | HAO-D Thermi | - | Non-muscat | - |
| 63 | 1563 | Tsaoussi | HAO-D Thermi | - | Non-muscat | - |
| 64 | 1564 | Koutsobeli Aspro | HAO-D Thermi | - | Non-muscat | - |
| 65 | 1565 | Platani | HAO-D Thermi | - | Non-muscat | - |
| 66 | 1566 | Vapsa Aspri | HAO-D Thermi | - | Non-muscat | - |
| 67 | 1568 | Chlores | HAO-D Thermi | - | Non-muscat | - |
| 68 | 1569 | Ntipelo Tserno | HAO-D Thermi | - | Non-muscat | - |
| 69 | 1570 | Aspofilero Mpourlogianni | HAO-D Thermi | - | Non-muscat | - |
| 70 | 1571 | Moschopatata | HAO-D Thermi | - | Non-muscat | - |
| 71 | 1572 | Aidani Aspro | HAO-D Thermi | - | Non-muscat | - |
| 72 | 1573 | Asprouda Zakynthou | HAO-D Thermi | - | Non-muscat | - |
| 73 | 1574 | Asprouda Santorinis | HAO-D Thermi | - | Non-muscat | - |
| 74 | 1575 | Asprouda Spetson | HAO-D Thermi | - | Non-muscat | - |
| 75 | 1576 | Votsiki | HAO-D Thermi | - | Non-muscat | - |
| 76 | 1577 | Mpelenes | HAO-D Thermi | - | Non-muscat | - |
| 77 | 1578 | Moschardinia | HAO-D Thermi | - | Non-muscat | - |
| 78 | 1579 | Amerikaniko | HAO-D Thermi | - | Non-muscat | - |
| 79 | 1580 | Potamisio | HAO-D Thermi | - | Non-muscat | - |
| 80 | 1581 | Zakynthino | HAO-D Thermi | - | Non-muscat | - |
| 81 | 1582 | Vertzami Aspro | HAO-D Thermi | - | Non-muscat | - |
| 82 | 1583 | Proimo Moschoudi | HAO-D Thermi | - | Non-muscat | - |
| 83 | 1584 | Asproudi | HAO-D Thermi | - | Non-muscat | - |
| 84 | 1585 | Mpampa Chasan | HAO-D Thermi | - | Non-muscat | - |
| 85 | 1586 | Kozanitis | HAO-D Thermi | - | Non-muscat | - |
| 86 | 1587 | Kranidiotiko | HAO-D Thermi | - | Non-muscat | - |
| 87 | 1588 | Arkadino | HAO-D Thermi | - | Non-muscat | - |
| 88 | 1589 | Katsano | HAO-D Thermi | - | Non-muscat | - |
| 89 | 1590 | Petrokoritho | HAO-D Thermi | - | Non-muscat | - |
| 90 | 1591 | Sklava | HAO-D Thermi | - | Non-muscat | - |
| 91 | 1592 | Atsala | HAO-D Thermi | - | Non-muscat | - |
| 92 | 1593 | Skiadopoulo | HAO-D Thermi | - | Non-muscat | - |
| 93 | 1594 | Dafni | HAO-D Thermi | - | Non-muscat | - |
| 94 | 1595 | Pechlou | HAO-D Thermi | - | Non-muscat | - |
| 95 | 1596 | Xerihi kokkino | HAO-D Thermi | - | Non-muscat | - |
| 96 | 1597 | Xeromacherouda | HAO-D Thermi | - | Non-muscat | - |
| 97 | 1598 | Psarosyriko | HAO-D Thermi | - | Non-muscat | - |
| 98 | 1599 | Neroproimies | HAO-D Thermi | - | Non-muscat | - |
| 99 | 1600 | Vlachiko | HAO-D Thermi | - | Non-muscat | - |
| 100 | 1601 | Korfiatis | HAO-D Thermi | - | Non-muscat | - |
| 101 | 1602 | Karystino | HAO-D Thermi | - | Non-muscat | - |
| 102 | 1603 | Stavrochiotiko | HAO-D Thermi | - | Non-muscat | - |
| 103 | 2001 | Moschato Alexandrias | AUTh Thermi | √ | Muscat | √ |
| 104 | 2002 | Moschato Samou | AUTh Thermi | √ | Muscat | √ |
| 105 | 2003 | Moschato Amvourgou | AUTh Thermi | √ | Muscat | - |
| 106 | 2004 | Moschato Rhodou (Hybrid) | AUTh Thermi | √ | Muscat | - |
| 107 | 2005 | Moschato di Terracina | AUTh Thermi | √ | Muscat | - |
| 108 | 2006 | Muscat d’einseinsent | AUTh Thermi | √ | Muscat | - |
| 109 | 2007 | Moschomavro | AUTh Thermi | - | Non-muscat | - |
| 110 | 2008 | Traminer | AUTh Thermi | - | Non-muscat | √ |
| 111 | 2009 | Perle de Csaba | AUTh Thermi | √ | Muscat | - |
| 112 | 2010 | Italia | AUTh Thermi | √ | Muscat | - |
| 113 | 2011 | Moschopoula | AUTh Thermi | - | Non-muscat | - |
| 114 | 2012 | Malvasia aromatic | AUTh Thermi | - | Muscat | - |
| 115 | 2013 | Moschardinia | AUTh Thermi | - | Muscat | - |
| 116 | 2014 | Roditis | AUTh Thermi | - | Non-muscat | √ |
| 117 | 2015 | Savvatiano | AUTh Thermi | - | Non-muscat | √ |
| 118 | 2016 | Limnio | AUTh Thermi | - | Non-muscat | - |
| 119 | 51 | Moschato Samou | HAO-D Crete | √ | Muscat | - |
| 120 | 52 | Kotsifali | HAO-D Crete | - | Non-muscat | - |
| 121 | 54 | Plyto | HAO-D Crete | - | Non-muscat | - |
| 122 | 55 | Moschato sp. | HAO-D Crete | √ | Muscat | - |
| 123 | 56 | Cabernet Sauvignon | HAO-D Crete | - | Non-muscat | - |
| 124 | 57 | Soultanina | HAO-D Crete | - | Non-muscat | - |
| 125 | 58 | Vilana | HAO-D Crete | - | Non-muscat | - |
| 126 | 60 | Mandilari | HAO-D Crete | - | Non-muscat | - |
| 127 | 63 | Liatiko | HAO-D Crete | - | Non-muscat | - |
| 128 | 66 | Agria | HAO-D Crete | - | Non-muscat | - |
HRM-PCR reactions were performed in a Rotor-Gene 6000 cycler with a final volume of 20 μl, containing 1X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 2 μl of 40 pmol of each primer (Vvi-1799f: agagaattacgagaggttgc, and Vvi-1823r: cgagcatattcatcaacttttg), 1.5 mM Syto® 9 green fluorescent nucleic acid stain, 1 U Kapa Taq DNA polymerase (Kapa Biosystems, USA) and 30 ng of DNA template. Cycling conditions consisted of an initial denaturation step of 3 min at 95 °C, followed by 40 cycles of 20 s at 95 °C, 20 s at 56 °C and 20 s at 72 °C. The final melting step ramped from 70 to 90 °C, with 0.1 °C increments and 2 s at each temperature. The Rotor-Gene 6000 proprietary software (version 2.0.2) was used for SNP allele determination. The normalized raw curve depicting the decreasing fluorescence versus increasing temperature and first differential curves were mainly used.
PCR products were directly sequenced in two directions for each product with Big Dye terminator v3.1 Cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) in an automated ABI 3730 sequencer (PE Applied Biosystems). The sequences were aligned with the CLUSTAL W program.
Results and discussion
Application of the traditional methods for the production of new grapevine varieties represent space-, labour- and time-consuming procedures that require highly specialized staff and may last many years. Modern approaches involve the use of functional molecular markers that accelerate and direct the selection procedures. The VviDXS gene is such a functional molecular marker that allows early and easy discrimination of the muscat varieties from the non-muscat ones (Emanuelli et al. 2014). The only significant and consistent difference between muscat and non-muscat grapevine varieties appears to be at position 1822 of the gene: muscat varieties have a thymine (“T) whereas non-muscats have a guanine (“G”). Further, SNP1822G>T causes a dominant gain-of-function substitution and was found to be strongly associated with muscat-flavored genotypes (Emanuelli et al., 2014).
A pair of primers (Vvi-1799f and Vvi-1823r) was initially designed on the functional SNP area and an HRM assay was employed. Varieties such as “Savvatiano”, “Roditis” and “Limnio” were included as negative controls since it is widely known that they lack muscat aromas. Among the 128 genotypes, 15 genotypes displayed the muscat melting curve (HRM profile) produced by SNP1822G<T specific marker whereas all the remaining genotypes displayed the non-muscat HRM profile (Table 1). There was 100% concordance between HRM analysis and the direct DNA sequencing (Table 1). The sequence region covering VviDXS (SNP1822G<T) of five different genotype samples, muscats and non-muscats, are presented in Figure 1. Compared with DNA sequencing, both sensitivity and specificity of the HRM analysis for the -1822 G>T SNP were 100%.

Figure 1. Muscat genotyping with HRM analysis of SNP1822 G/T functional marker in a set of grapevine cultivars. A) Normalized HRM curve analysis; (B) HRM differential plot using “Moschato Amvourgou” as reference genotype. A single nucleotide polymorphism (SNP) within VviDXS (SNP1822 G<T) causes a dominant gain-of-function K284N substitution associated with muscat-flavored genotypes. C) Sequence alignment of five representative grapevine varieties confirming the SNP area.
Figure 1a depicts the normalized HRM melting curves of representative grapevine varieties, using the marker SNP1822G>T. Using the shape of the melting curves (Ganopoulos et al. 2011) we could reveal the differences between the genotypes under investigation and show that all genotypes used could be easily grouped according to their muscat or non-muscat flavor by viewing their melting curves (Fig. 1a and 1b); varieties “Moschato Amvourgou” and ”Savvatiano” were used as positive and negative indicators, respectively. At present, we are not aware of studies on the terpenoid compound content of the autochthonous Greek varieties; in the current study the denotation of a Greek variety either as “muscat” or “non-muscat” was based on our empirical observations. In our study, we analyzed varieties from our ex-situ collections together with international muscat varieties, such as Perle de Csaba, Italia, Muscat d’einseinsent, Moschato di Terracina, Moschato Alexandrias (Muscat of Alexandria: a well-known international variety of Greek origin), and Moschato Amvourgou (Muscat of Hamburg), that were also used as positive indicators of the muscat character.
Our approach grouped all the known muscat varieties together in one group whereas all the non-muscats were grouped in another. Interestingly, varieties possessing the muscat-related prefix “Moscho”, such as “Moschopoula”, various “Moschofilero”, “Moschomavro”, “Proimo Moschoudi”, and “Moschopatata”, were classified as non-muscats. On the contrary, there were two varieties, “Mavro Tragano” and “Robola Aspri”, that were grouped in the muscat group although there was no such previous knowledge (Table 1). To investigate further the muscat character stability within “Mavro Tragano” and “Robola Aspri”, the allelic state of SNP1822 was assessed as above on additional 9 individual plants of “Mavro Tragano”, 8 individual plants of “Robola Aspri”, and 7 individual plants of “Moschato Alexandrias” (data not shown). Results confirmed initial variety assignment. It seems that the muscat flavor in “Mavro Tragano” and “Robola Aspri” is covered by other compounds and therefore it escaped detection by the conventional methods (Battilana et al., 2011). Alternatively, it is likely that metabolic steps along the plastidic MEP pathway and downstream of DXS, whereupon DXS catalyzes the production of DXP (1-deoxy-D-xylulose-5-phosphate) from pyruvate and D-glyceraldehyde-3-phosphate, may be inactive leading to covering the muscat predisposition. Further, the probable cross talk between MEP and the mevalonate pathways of terpene biosynthesis leads to a less than perfect correspondence between the “T” allele and the muscat aroma.
Accession “Moschardinia” originated from the AUTh collection (Table 1, accession 2013) was classified in the muscat group where as accession “Moschardinia” from the HAO-D (Table 1, accession 1578) was classified in the non-muscat group, requiring further investigation. Therefore, the autochthonous varieties of the Greek germplasm, genotyping is a vital and urgent issue that will set the basis for the development of authentication and breeding activities (Merkouropoulos et al. 2015).
Considering the very latest developments we suggest the use of the VviDXS gene as an additional OIV descriptor confirming the muscat flavor in grapes. Viticulture, wine production and consumption have expanded in areas outside the traditional European vineyards where the muscat character is phenotypically assessed. SNP1822 of the DXS gene may be used in areas with a new interest in viticulture and wine production as an additional marker that specifies and authenticates the final product: table fruit or wine.
References
- Battilana J., Costantini L., Emanuelli F., Sevini F., Segala C., Moser S., Velasco R., Versini G., and Grando M.S., 2009. The 1-deoxy-d-xylulose 5-phosphate synthase gene co-localizes with a major QTL affecting monoterpene content in grapevine. Theor Appl Genet, 118, 653-669. doi:10.1007/s00122-008-0927-8
- Battilana J., Emanuelli F., Gambino G., Gribaudo I., Gasperi F., Boss P.K., Grando M.S., 2011. Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation. J Exp Bot, 62, 5497-5508. doi:10.1093/jxb/err231
- Emanuelli F., M. Sordo, S. Lorenzi, J. Battilana, and M.S. Grando. 2014. Development of user-friendly functional molecular markers for VvDXS gene conferring muscat flavor in grapevine. Mol Breeding, 33, 235-241. doi:10.1007/s11032-013-9929-6
- Ganopoulos I., Argiriou A., Tsaftaris A. 2011. Microsatellite high resolution melting (SSR-HRM) analysis for authenticity testing of protected designation of origin (PDO) sweet cherry products. Food Control, 22, 532-541. doi:10.1016/j.foodcont.2010.09.040
- Ganopoulos I., Tsaballa A., Xanthopoulou A., Madesis P., Tsaftaris A., 2013. Sweet cherry cultivar identification by high-resolution-melting (HRM) analysis using gene-based SNP markers. Plant Mol Biol Rep, 31, 763-768. doi:10.1007/s11105-012-0538-z
- Merkouropoulos G., Michailidou S., Alifragkis A., Zioziou E., Koundouras S., Argiriou A., Nicolaou N., 2015. A combined approach involving ampelographic description, berry oenological traits and molecular analysis to study native grapevine varieties of Greece. VITIS- Journal of Grapevine Research, 54, 99-103

Views: 2152
PDF: 545