Original research articles

High Resolution Melting (HRM) analysis on VviDXS to reveal muscats or non-muscats among autochthonous Greek wine producing grape varieties

Abstract

Muscat flavor in grapes is associated with a substitution of a Single Nucleotide Polymorphism (SNP) located at position 1822 (SNP1822G>T) within the coding sequence of the VviDXS gene. Various methods, including the use of High Resolution Melting (HRM) analysis, have been suggested to discriminate different SNP allelic states including the molecular discrimination of the muscat from the non-muscat grape varieties, thus providing the ability to minimize lengthy grape breeding programs when selecting for grape muscat flavor before the fruit maturity stage. HRM analysis on the SNP1822 was performed on a group of 128 wine producing grape varieties in order to separate the muscat from the non-muscat genotypes before they are used for further breeding activities. This approach could be used either as a single-step prescreening method or in accordance with recently published methodology to elucidate on varietal characterization and authentication as these are important requirements concerning nurseries, growers and winemakers.

Introduction

Wine aroma is the final and combinatorial outcome of many genetic and environmental factors, and represents one of the most important and complex characters that highly contribute to the sensory experience and the market value of the product.

The muscat aroma of many grapevine varieties is due to the occurrence of high levels of terpenoid compounds, such as linalool, nerol, α-terpineol, and geraniol. The 1-deoxy-D-xylulose-5-phospate synthase (VviDXS) gene that converts glyceraldehyde 3-phosphate and pyruvate into 1-deoxy-D-xylulose-5-phosphate (DXP) has recently been identified as a functional molecular marker associated with the occurrence of muscat flavor in grapevine (Battilana et al. 2009). Three alternative methods have been developed allowing for large-scale screening and facilitating prompt germplasm characterization in grapevine breeding based on the occurrence of four functional SNPs (SNP1784T>C, SNP1822G>T, SNP1917A>G, and SNP1922C>T) on the VviDXS gene (Emanuelli et al. 2014).

High-resolution melting analysis (HRM) is a cost-effective and less time-consuming method that could detect polymorphisms even at the single nucleotide level measuring the rate of double-stranded DNA dissociation to single-stranded DNA with increasing temperature. HRM has been performed in the successful identification of plant varieties in other species (Ganopoulos et al. 2013).

Here, we focused on SNP1822G>T, introducing an HRM approach in order to molecularly predict the muscat flavor and also detect hidden muscat potential of wine producing varieties. We suggest that this approach could be used either as a single-step pre-screening method or as an auxiliary method to discriminate the muscat from the non-muscat varieties within the Greek grape germplasm.

Materials and methods

Young leaves from a total of 122 autochthonous wine producing Greek varieties were collected and stored at -80°C until analyzed (Table 1). In addition, samples from 6 international varieties were collected and treated similarly, totaling 128 samples. Genetic material is maintained in three collections: i) the ampelographic collection of the Greek Gene Bank, at the Institute of Plant Breeding and Genetic Resources (GGB) of the Hellenic Agricultural Organization 'Demeter' (hereafter HAO-D) at Thermi (Thessaloniki, Greece), ii) the ampelographic collection of the School of Agriculture of the Aristotle University of Thessaloniki (hereafter AUTh collection) (Merkouropoulos et al. 2015), and iii) the grapevine collection of HAO-D at Ampelouzos (Crete, Greece). All DNA isolations were performed using the NucleoSpin Plant II Kit (Macherey Nagel, Duren, Germany) according to the manufacturer’s instructions.

Table 1. HRM genotyping data relating to the 128 Muscat and non-Muscat grapevine varieties analyzed used in this study.


No Accession number Variety name Maintained at Empirically known muscats HRM profile
SNP1822G>T
Sequencing confirmation
of position 1822
1 1501 Negoska HAO-D Thermi - Non-muscat -  
2 1502 Roditis HAO-D Thermi - Non-muscat -
3 1503 Atesa HAO-D Thermi - Non-muscat -
4 1504 Pamidi HAO-D Thermi - Non-muscat -
5 1505 Fartsalo HAO-D Thermi - Non-muscat -
6 1506 Xanthofilero HAO-D Thermi - Non-muscat -
7 1507 Moschofilero Campa HAO-D Thermi - Non-muscat -
8 1508 Moschofilero Proskinitari HAO-D Thermi - Non-muscat -
9 1509 Mavro Kalavritino HAO-D Thermi - Non-muscat -
10 1510 Zalovitiko HAO-D Thermi - Non-muscat -
11 1511 Mavrokorakas HAO-D Thermi - Non-muscat -
12 1512 Koumari HAO-D Thermi - Non-muscat -
13 1513 Tsampato HAO-D Thermi - Non-muscat -
14 1514 Proniko HAO-D Thermi - Non-muscat -
15 1515 Mavro Tragano HAO-D Thermi - Muscat -
16 1516 Aidani Mavro HAO-D Thermi - Non-muscat -
17 1517 Piperionos HAO-D Thermi - Non-muscat -
18 1518 Karapapas HAO-D Thermi - Non-muscat -
19 1519 Pargino HAO-D Thermi - Non-muscat -
20 1520 Kahpetsi Ooides HAO-D Thermi - Non-muscat -
21 1521 Araklinos HAO-D Thermi - Non-muscat -
22 1522 Tenedio HAO-D Thermi - Non-muscat -
23 1523 Romeiko HAO-D Thermi - Non-muscat -
24 1524 Roditis Galanos HAO-D Thermi - Non-muscat -
25 1525 Mavroudi HAO-D Thermi - Non-muscat -
26 1526 Moschofilero HAO-D Thermi - Non-muscat -
27 1527 Koritsanos Mavros HAO-D Thermi - Non-muscat -
28 1528 Mavro Cyprus HAO-D Thermi - Non-muscat -
29 1529 Avgoustela HAO-D Thermi - Non-muscat -
30 1530 Diminitis HAO-D Thermi - Non-muscat -
31 1531 Chrysostafilo HAO-D Thermi - Non-muscat -
32 1532 Kokkinovostitsa HAO-D Thermi - Non-muscat -
33 1533 Filoksenis HAO-D Thermi - Non-muscat -
34 1534 Limperaki HAO-D Thermi - Non-muscat -
35 1535 Sikiotis HAO-D Thermi - Non-muscat -
36 1536 Trinka HAO-D Thermi - Non-muscat -
37 1537 Pardala HAO-D Thermi - Non-muscat -
38 1538 Mpoutinou HAO-D Thermi - Non-muscat -
39 1539 Mesoproimadi HAO-D Thermi - Non-muscat -
40 1540 Karambraimis HAO-D Thermi - Non-muscat -
41 1541 Xynogaltso de Kozani HAO-D Thermi - Non-muscat -
42 1542 Giourikiko HAO-D Thermi - Non-muscat -
43 1543 Glykopati HAO-D Thermi - Non-muscat -
44 1544 Violento HAO-D Thermi - Non-muscat -
45 1545 Skylopnichtis Kokkinos HAO-D Thermi - Non-muscat -
46 1546 Chondromavro HAO-D Thermi - Non-muscat -
47 1547 Koutsoupia HAO-D Thermi - Non-muscat -
48 1548 Athinies HAO-D Thermi - Non-muscat -
49 1549 Skopelitiko HAO-D Thermi - Non-muscat -
50 1550 Svarna HAO-D Thermi - Non-muscat -
51 1551 Flora HAO-D Thermi - Non-muscat -
52 1552 Chouchouliatis HAO-D Thermi - Non-muscat -
53 1553 Arkoudocheria HAO-D Thermi - Non-muscat -
54 1554 Mpiritsia HAO-D Thermi - Non-muscat -
55 1555 Moschato Alexandrias HAO-D Thermi Muscat -
56 1556 Robola Aspri HAO-D Thermi - Muscat -
57 1557 Askathari HAO-D Thermi - Non-muscat -
58 1558 Keserlidiko HAO-D Thermi - Non-muscat -
59 1559 Priknadi HAO-D Thermi - Non-muscat -
60 1560 Thrapsathiri HAO-D Thermi - Non-muscat -
61 1561 Vidiano HAO-D Thermi - Non-muscat -
62 1562 Doumbrena Aspri HAO-D Thermi - Non-muscat -
63 1563 Tsaoussi HAO-D Thermi - Non-muscat -
64 1564 Koutsobeli Aspro HAO-D Thermi - Non-muscat -
65 1565 Platani HAO-D Thermi - Non-muscat -
66 1566 Vapsa Aspri HAO-D Thermi - Non-muscat -
67 1568 Chlores HAO-D Thermi - Non-muscat -
68 1569 Ntipelo Tserno HAO-D Thermi - Non-muscat -
69 1570 Aspofilero Mpourlogianni HAO-D Thermi - Non-muscat -
70 1571 Moschopatata HAO-D Thermi - Non-muscat -
71 1572 Aidani Aspro HAO-D Thermi - Non-muscat -
72 1573 Asprouda Zakynthou HAO-D Thermi - Non-muscat -
73 1574 Asprouda Santorinis HAO-D Thermi - Non-muscat -
74 1575 Asprouda Spetson HAO-D Thermi - Non-muscat -
75 1576 Votsiki HAO-D Thermi - Non-muscat -
76 1577 Mpelenes HAO-D Thermi - Non-muscat -
77 1578 Moschardinia HAO-D Thermi - Non-muscat -
78 1579 Amerikaniko HAO-D Thermi - Non-muscat -
79 1580 Potamisio HAO-D Thermi - Non-muscat -
80 1581 Zakynthino HAO-D Thermi - Non-muscat -
81 1582 Vertzami Aspro HAO-D Thermi - Non-muscat -
82 1583 Proimo Moschoudi HAO-D Thermi - Non-muscat -
83 1584 Asproudi HAO-D Thermi - Non-muscat -
84 1585 Mpampa Chasan HAO-D Thermi - Non-muscat -
85 1586 Kozanitis HAO-D Thermi - Non-muscat -
86 1587 Kranidiotiko HAO-D Thermi - Non-muscat -
87 1588 Arkadino HAO-D Thermi - Non-muscat -
88 1589 Katsano HAO-D Thermi - Non-muscat -
89 1590 Petrokoritho HAO-D Thermi - Non-muscat -
90 1591 Sklava HAO-D Thermi - Non-muscat -
91 1592 Atsala HAO-D Thermi - Non-muscat -
92 1593 Skiadopoulo HAO-D Thermi - Non-muscat -
93 1594 Dafni HAO-D Thermi - Non-muscat -
94 1595 Pechlou HAO-D Thermi - Non-muscat -
95 1596 Xerihi kokkino HAO-D Thermi - Non-muscat -
96 1597 Xeromacherouda HAO-D Thermi - Non-muscat -
97 1598 Psarosyriko HAO-D Thermi - Non-muscat -
98 1599 Neroproimies HAO-D Thermi - Non-muscat -
99 1600 Vlachiko HAO-D Thermi - Non-muscat -
100 1601 Korfiatis HAO-D Thermi - Non-muscat -
101 1602 Karystino HAO-D Thermi - Non-muscat -
102 1603 Stavrochiotiko HAO-D Thermi - Non-muscat -
103 2001 Moschato Alexandrias AUTh Thermi Muscat
104 2002 Moschato Samou AUTh Thermi Muscat
105 2003 Moschato Amvourgou AUTh Thermi Muscat -
106 2004 Moschato Rhodou (Hybrid) AUTh Thermi Muscat -
107 2005 Moschato di Terracina AUTh Thermi Muscat -
108 2006 Muscat d’einseinsent AUTh Thermi Muscat -
109 2007 Moschomavro AUTh Thermi - Non-muscat -
110 2008 Traminer AUTh Thermi - Non-muscat
111 2009 Perle de Csaba AUTh Thermi Muscat -
112 2010 Italia AUTh Thermi Muscat -
113 2011 Moschopoula AUTh Thermi - Non-muscat -
114 2012 Malvasia aromatic AUTh Thermi - Muscat -
115 2013 Moschardinia AUTh Thermi - Muscat -
116 2014 Roditis AUTh Thermi - Non-muscat
117 2015 Savvatiano AUTh Thermi - Non-muscat
118 2016 Limnio AUTh Thermi - Non-muscat -
119 51 Moschato Samou HAO-D Crete Muscat -
120 52 Kotsifali HAO-D Crete - Non-muscat -
121 54 Plyto HAO-D Crete - Non-muscat -
122 55 Moschato sp. HAO-D Crete Muscat -
123 56 Cabernet Sauvignon HAO-D Crete - Non-muscat -
124 57 Soultanina HAO-D Crete - Non-muscat -
125 58 Vilana HAO-D Crete - Non-muscat -
126 60 Mandilari HAO-D Crete - Non-muscat -
127 63 Liatiko HAO-D Crete - Non-muscat -
128 66 Agria HAO-D Crete - Non-muscat -

HRM-PCR reactions were performed in a Rotor-Gene 6000 cycler with a final volume of 20 μl, containing 1X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 2 μl of 40 pmol of each primer (Vvi-1799f: agagaattacgagaggttgc, and Vvi-1823r: cgagcatattcatcaacttttg), 1.5 mM Syto® 9 green fluorescent nucleic acid stain, 1 U Kapa Taq DNA polymerase (Kapa Biosystems, USA) and 30 ng of DNA template. Cycling conditions consisted of an initial denaturation step of 3 min at 95 °C, followed by 40 cycles of 20 s at 95 °C, 20 s at 56 °C and 20 s at 72 °C. The final melting step ramped from 70 to 90 °C, with 0.1 °C increments and 2 s at each temperature. The Rotor-Gene 6000 proprietary software (version 2.0.2) was used for SNP allele determination. The normalized raw curve depicting the decreasing fluorescence versus increasing temperature and first differential curves were mainly used.

PCR products were directly sequenced in two directions for each product with Big Dye terminator v3.1 Cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA) in an automated ABI 3730 sequencer (PE Applied Biosystems). The sequences were aligned with the CLUSTAL W program.

Results and discussion

Application of the traditional methods for the production of new grapevine varieties represent space-, labour- and time-consuming procedures that require highly specialized staff and may last many years. Modern approaches involve the use of functional molecular markers that accelerate and direct the selection procedures. The VviDXS gene is such a functional molecular marker that allows early and easy discrimination of the muscat varieties from the non-muscat ones (Emanuelli et al. 2014). The only significant and consistent difference between muscat and non-muscat grapevine varieties appears to be at position 1822 of the gene: muscat varieties have a thymine (“T) whereas non-muscats have a guanine (“G”). Further, SNP1822G>T causes a dominant gain-of-function substitution and was found to be strongly associated with muscat-flavored genotypes (Emanuelli et al., 2014).

A pair of primers (Vvi-1799f and Vvi-1823r) was initially designed on the functional SNP area and an HRM assay was employed. Varieties such as “Savvatiano”, “Roditis” and “Limnio” were included as negative controls since it is widely known that they lack muscat aromas. Among the 128 genotypes, 15 genotypes displayed the muscat melting curve (HRM profile) produced by SNP1822G<T specific marker whereas all the remaining genotypes displayed the non-muscat HRM profile (Table 1). There was 100% concordance between HRM analysis and the direct DNA sequencing (Table 1). The sequence region covering VviDXS (SNP1822G<T) of five different genotype samples, muscats and non-muscats, are presented in Figure 1. Compared with DNA sequencing, both sensitivity and specificity of the HRM analysis for the -1822 G>T SNP were 100%.

Figure 1. Muscat genotyping with HRM analysis of SNP1822 G/T functional marker in a set of grapevine cultivars. A) Normalized HRM curve analysis; (B) HRM differential plot using “Moschato Amvourgou” as reference genotype. A single nucleotide polymorphism (SNP) within VviDXS (SNP1822 G<T) causes a dominant gain-of-function K284N substitution associated with muscat-flavored genotypes. C) Sequence alignment of five representative grapevine varieties confirming the SNP area.

Figure 1a depicts the normalized HRM melting curves of representative grapevine varieties, using the marker SNP1822G>T. Using the shape of the melting curves (Ganopoulos et al. 2011) we could reveal the differences between the genotypes under investigation and show that all genotypes used could be easily grouped according to their muscat or non-muscat flavor by viewing their melting curves (Fig. 1a and 1b); varieties “Moschato Amvourgou” and ”Savvatiano” were used as positive and negative indicators, respectively. At present, we are not aware of studies on the terpenoid compound content of the autochthonous Greek varieties; in the current study the denotation of a Greek variety either as “muscat” or “non-muscat” was based on our empirical observations. In our study, we analyzed varieties from our ex-situ collections together with international muscat varieties, such as Perle de Csaba, Italia, Muscat d’einseinsent, Moschato di Terracina, Moschato Alexandrias (Muscat of Alexandria: a well-known international variety of Greek origin), and Moschato Amvourgou (Muscat of Hamburg), that were also used as positive indicators of the muscat character.

Our approach grouped all the known muscat varieties together in one group whereas all the non-muscats were grouped in another. Interestingly, varieties possessing the muscat-related prefix “Moscho”, such as “Moschopoula”, various “Moschofilero”, “Moschomavro”, “Proimo Moschoudi”, and “Moschopatata”, were classified as non-muscats. On the contrary, there were two varieties, “Mavro Tragano” and “Robola Aspri”, that were grouped in the muscat group although there was no such previous knowledge (Table 1). To investigate further the muscat character stability within “Mavro Tragano” and “Robola Aspri”, the allelic state of SNP1822 was assessed as above on additional 9 individual plants of “Mavro Tragano”, 8 individual plants of “Robola Aspri”, and 7 individual plants of “Moschato Alexandrias” (data not shown). Results confirmed initial variety assignment. It seems that the muscat flavor in “Mavro Tragano” and “Robola Aspri” is covered by other compounds and therefore it escaped detection by the conventional methods (Battilana et al., 2011). Alternatively, it is likely that metabolic steps along the plastidic MEP pathway and downstream of DXS, whereupon DXS catalyzes the production of DXP (1-deoxy-D-xylulose-5-phosphate) from pyruvate and D-glyceraldehyde-3-phosphate, may be inactive leading to covering the muscat predisposition. Further, the probable cross talk between MEP and the mevalonate pathways of terpene biosynthesis leads to a less than perfect correspondence between the “T” allele and the muscat aroma.

Accession “Moschardinia” originated from the AUTh collection (Table 1, accession 2013) was classified in the muscat group where as accession “Moschardinia” from the HAO-D (Table 1, accession 1578) was classified in the non-muscat group, requiring further investigation. Therefore, the autochthonous varieties of the Greek germplasm, genotyping is a vital and urgent issue that will set the basis for the development of authentication and breeding activities (Merkouropoulos et al. 2015).

Considering the very latest developments we suggest the use of the VviDXS gene as an additional OIV descriptor confirming the muscat flavor in grapes. Viticulture, wine production and consumption have expanded in areas outside the traditional European vineyards where the muscat character is phenotypically assessed. SNP1822 of the DXS gene may be used in areas with a new interest in viticulture and wine production as an additional marker that specifies and authenticates the final product: table fruit or wine.

References

  • Battilana J., Costantini L., Emanuelli F., Sevini F., Segala C., Moser S., Velasco R., Versini G., and Grando M.S., 2009. The 1-deoxy-d-xylulose 5-phosphate synthase gene co-localizes with a major QTL affecting monoterpene content in grapevine. Theor Appl Genet, 118, 653-669. doi:10.1007/s00122-008-0927-8
  • Battilana J., Emanuelli F., Gambino G., Gribaudo I., Gasperi F., Boss P.K., Grando M.S., 2011. Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation. J Exp Bot, 62, 5497-5508. doi:10.1093/jxb/err231
  • Emanuelli F., M. Sordo, S. Lorenzi, J. Battilana, and M.S. Grando. 2014. Development of user-friendly functional molecular markers for VvDXS gene conferring muscat flavor in grapevine. Mol Breeding, 33, 235-241. doi:10.1007/s11032-013-9929-6
  • Ganopoulos I., Argiriou A., Tsaftaris A. 2011. Microsatellite high resolution melting (SSR-HRM) analysis for authenticity testing of protected designation of origin (PDO) sweet cherry products. Food Control, 22, 532-541. doi:10.1016/j.foodcont.2010.09.040
  • Ganopoulos I., Tsaballa A., Xanthopoulou A., Madesis P., Tsaftaris A., 2013. Sweet cherry cultivar identification by high-resolution-melting (HRM) analysis using gene-based SNP markers. Plant Mol Biol Rep, 31, 763-768. doi:10.1007/s11105-012-0538-z
  • Merkouropoulos G., Michailidou S., Alifragkis A., Zioziou E., Koundouras S., Argiriou A., Nicolaou N., 2015. A combined approach involving ampelographic description, berry oenological traits and molecular analysis to study native grapevine varieties of Greece. VITIS- Journal of Grapevine Research, 54, 99-103

Authors


Georgios Merkouropoulos

georgios.merkouropoulos@gmail.com

Affiliation : Hellenic Agricultural Organization 'Demeter', Institute of Plant Breeding & Genetic Resources, Greek Gene Bank, 57001 Thermi, Greece; Institute of Applied Biosciences, CERTH, Thermi, Thessaloniki, 570 01, Greece


Ioannis Ganopoulos

Affiliation : Institute of Applied Biosciences, CERTH, Thermi, Thessaloniki, 570 01, Greece


Andreas Doulis

Affiliation : Laboratory of Plant Biotechnology, Institute of Olive Tree Subtropical Crops and Viticulture, Hellenic Agricultural Organization 'Demeter' (ex. NAGREF), GR-73100, Heraklion, Greece


Nikolaos Nikolaou

Affiliation : Aristotle University of Thessaloniki, School of Agriculture, Laboratory of Viticulture, Thessaloniki, Greece


Photini Mylona

Affiliation : Hellenic Agricultural Organization 'Demeter', Institute of Plant Breeding & Genetic Resources, Greek Gene Bank, 57001 Thermi, Greece

Attachments

No supporting information for this article

Article statistics

Views: 2152

Downloads

PDF: 545

Citations

PlumX