VITICULTURE / Original research article

Hot water treatment combined with Trichoderma inoculation in the nursery protects planting material against grapevine trunk disease

Abstract

Grapevine trunk diseases (GTDs) cause significant losses in viticulture. To enhance the phytosanitary quality of planting material, a method was developed to control the common GTD pathogens Phaeomoniella chlamydospora, Phaeoacremonium minimum, and Diplodia seriata using hot water treatment (HWT) and inoculation with the biocontrol agent Trichoderma atroviride SC1 (Vintec®, Certis Belchim B. V.) (Ta SC1). Sensitivity of P. minimum and P. chlamydospora isolates to HWT was tested in vitro and in autoclaved wood at conidial and mycelium stages and at various time/temperature combinations (30 and 40 min at 40 °C, 45 °C, 50 °C and 55 °C). The results showed that P. minimum had greater tolerance to HWT compared to P. chlamydospora. Spore germination of all P. chlamydospora isolates was completely inhibited at 45 °C, while P. minimum isolate 117607 tolerated 50 °C. Mycelium growth of both pathogens was completely inhibited at 55 °C. In autoclaved wood, P. chlamydospora growth was inhibited after 30 min at 50 °C, while treatments for 45 min were necessary to inhibit the growth of P. minimum. In nursery experiments, cuttings were artificially inoculated and incubated with the pathogens and treated with HWT at 50 °C for 45 min under conditions of common viticultural practice. In these conditions, no recovery was recorded for P. chlamydospora and D. seriata seven days post-inoculation (dpi), but the survival rate of P. minimum was 5 %. In 2021, P. minimum recovered in 40 % of the samples six months post-inoculation, P. chlamydospora in 7 % twelve months post-inoculation, and D. seriata was eliminated. In 2022, D. seriata was detected in 10 % of samples six months post-inoculation and P. chlamydospora in 25 % of the samples twelve months post-inoculation. P. minimum recovered at all sampling time points during the assessment period. Combined applications of HWT and Ta SC1 provided protection of the planting material over the twelve months assessment period, with molecular analysis confirming 90 % recovery of Ta SC1. Field experiments carried out with naturally infected scions showed that HWT at 50 °C for 45 min significantly reduced the incidence of Diplodia spp. Overall, HWT effectively reduced GTD pathogens in grapevine planting material, and the combined treatment with Ta SC1 enhanced long-lasting protection in the nursery.

Introduction

Grapevine trunk diseases (GTDs) are present in nearly all wine-growing areas worldwide and are among the most destructive diseases of grapevine (Bertsch et al., 2013; Fischer & Peighami, 2019; Gramaje et al., 2018; Larignon & Dubos, 1997). GTDs comprise a complex of diseases, such as Esca, Petri disease, Eutypa dieback, and Botryosphaeria dieback (Úrbez-Torres et al., 2012; Fischer, 2006). The causal agents of these diseases are fungal pathogens that colonise the xylem tissue; these pathogens belong to 34 genera and more than 130 species of ascomycetes and basidiomycetes (Fischer & Kassemeyer, 2003; Gramaje et al., 2018). The most common organisms isolated from symptomatic grapevine trunks in Germany are Phaeomoniella chlamydospora, Phaeoacremonium minimum, Diplodia seriata, Eutypa lata, Phomopsis viticola, Fomitiporia mediterranea, and Cylindrocarpon destructans (Fischer & Kassemeyer, 2003). Pathogen infection of the woody tissue occurs primarily through wounds resulting from the annual pruning of established grapevine (Larignon & Dubos, 2000) or through the grafting of propagation material in the nursery (Gramaje et al., 2011; Gramaje et al., 2018). Infections in the nursery are commonly caused by Petri disease pathogens, P. chlamydospora (Crous & Gams, 2000) P. minimum (Crous et al., 1996), and species of the Botryosphaeriaceae (Fischer, 2006; Halleen et al., 2007; Gramaje & Armengol, 2011; Bertsch et al., 2013). Early infection of the planting material leads to significant losses in newly established vineyards due to stunted growth, wilting or dieback, and can serve as a source of areal inoculum for neighbouring vineyards (Aroca et al., 2010; Fourie & Halleen, 2004; Mugnai et al., 1999). Currently, no curative treatment is available for the control of these diseases (Bertsch et al., 2013; Mutawila et al., 2011). The elimination of fungal organisms from the xylem tissue is difficult, since standard chemical treatment methods do not access the inner tissue of grapevine cuttings (Gramaje & Armengol, 2011; Waite & May, 2005).

An alternative method for controlling GTD pathogens in dormant woody plant material is hot water treatment (HWT) (Crous et al., 2001; Laukart et al., 2001; Waite & May, 2005). However, contradictory results have been obtained in several studies on the effect of HWT against individual GTD pathogens conducted in different wine-growing regions worldwide: HWT at 50 °C for 30 min was effective in controlling Cylindrocarpon spp., (Bleach et al., 2013; Gramaje et al., 2010) and Neofusicoccum luteum (Elena et al., 2015); meanwhile, Lasiodiplodia theobromae, Phaeoacremonium inflatipes, and Neofusicoccum vitifusiforme tolerated treatments at 51 °C for 30 min (Elena et al., 2015; Rooney & Gubler, 2001). Additionally, the tolerance of P. chlamydospora and P. minimum to temperatures of 53 °C has been found in southern wine regions (Gramaje et al., 2008). The sensitivity of planting material to HWT has been shown to depend on the climate of the growing region and on grapevine variety: an increased loss of vitality and higher graft failure have been observed in cuttings treated with HWT grown in cooler wine-producing areas compared to treatment carried out on planting material grown in southern wine regions (Bleach et al., 2013; Waite & Morton, 2007).

Several biological control agents (BCAs) have been tested for their antagonistic activity against GTD pathogens. The Trichoderma spp. are among the most studied BCAs due to their wide-ranging modes of action; for example, direct antagonism, the release of volatile and non-volatile metabolites, and plant-growth-promoting abilities (Del Pilar Martínez-Diz et al., 2021; Di Marco et al., 2021; Fourie et al., 2001; Harman, 2006; Kotze et al., 2011; Leal et al., 2023; Leal et al., 2021). Several Trichoderma spp. are used in commercial products as suspension for dipping propagation material during propagation, as well as wound protectants that are applied after the pruning of established grapevines. The most common active ingredients of commercial bio-fungicides contain strains of Trichoderma koningii (TK7, Condor Shield®), Trichoderma atroviride (SC1, Vintec®) (Berbegal et al., 2020; Del Pilar Martínez-Diz et al., 2021; Leal et al., 2023; Leal et al., 2021), Trichoderma harzianum (T39, Trichodex®) (Di Marco et al., 2004), Trichoderma asperellum and Trichoderma gamsii (strain ICC 012 and ICC 080, Remedier®) (Di Marco et al., 2021).

HWT has not been found to provide long-lasting effects against targeted pathogens (Crous et al., 2001). Therefore, the aim of this study was to assess the efficacy of HWT against the most commonly occurring GTD pathogens in viticulture, and to test a combined treatment with Vintec® (Certis Belchim B. V.) containing Trichoderma atroviride SC1 (Ta SC1) to provide a durable protection of the planting material in the nursery against P. chlamydospora, P. minimum, and D. seriata.

Materials and methods

1. Experimental setup

In order to develop an effective HWT protocol, experiments were conducted both in vitro and in artificially inoculated autoclaved wood under sterile environmental conditions to determine the heat tolerance of the target fungal isolates (Figure 1). Thereafter, a nursery experiment was carried out under practical conditions to test the long-term effectiveness of a treatment alone and in combination with BCA application on artificially inoculated scion cuttings. Finally, the HWT protocol was implemented on naturally infected scion cuttings, where the pathogen presence was assessed via real-time polymerase chain reaction (PCR).

Figure 1. Diagram showing the workflow of the protocol development for hot water treatment (HWT) applied to eliminate GTD pathogens during the grapevine propagation process (CFU = colony forming unit, MEA = malt extract agar, Ta SC1 = Trichoderma atroviride SC1).

2. Fungal organisms

The effect of HWT was tested on P. chlamydospora, P. minimum and D. seriata. Three isolates per species were used in this study, except for D. seriata for which one isolate was tested. Commercially available isolates, obtained from the DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, and isolates from the Institute of Plant Protection, Dienstleistungszentrum Ländlicher Raum (DLR) Rheinpfalz were included (Table 1). All the fungal isolates were cultivated on 2 % malt extract agar (MEA; 2 % agar, 2 % malt extract) plates, except for D. seriata, which was grown on 4 % oatmeal agar (2 % agar, 4 % oatmeal). Fungal colonies were sub-cultured monthly on agar plates and incubated in the dark at 21 °C in a cultivation chamber.

Table 1. Fungal isolates used in the experiments, comprising naturally occurring and commercially available isolates.

Species

Strain

Abbreviation

Strain collection

Geographic origin

Botryosphaeria

Diplodia seriata

41

Dse41

DLR

Italy

Phaeomoniella

P. chlamydospora

CBS 117 179

Pch117179

DSMZ

South Africa

P. chlamydospora

CBS 101 571

Pch101571

DSMZ

USA

P. chlamydospora

9886

Pch9886

DLR

Germany

Phaeoacremonium

P. minimum

CBS 117 607

Pmi117607

DSMZ

Italy

P. minimum

CBS 631.94

Pmi63194

DSMZ

Italy

P. minimum

9896

Pmi9896

DLR

Germany

3. Preparation of spore suspensions

Liquid spore suspensions of P. chlamydospora and P. minimum were prepared by flooding 2-3-week-old colonies grown on agar plates with sterile distilled water. In the case of D. seriata, a spore suspension was prepared according to Úrbez-Torres et al. (2010). The suspensions were filtered through a 30 µm pore diameter sterile gauze and the densities were adjusted to 104 spores/mL using a hemocytometer (Fuchs Rosenthal Counting Chamber, NanoEnTek Inc., Waltham, USA).

4. In vitro experiment on the sensitivity of fungal spores and mycelium to HWT

The sensitivity to HWT of the ungerminated spores and mycelium development of P. chlamydospora and P. minimum was determined in a laboratory experiment (Figure 1). For each fungal pathogen, three isolates listed in Table 1 were tested individually. Therefore, a 50 mL spore suspension of the isolates was prepared and suspended in distilled water (spore suspension) or in 2 % liquid malt extract (ME; mycelium suspension), obtaining a final volume of 100 mL in a 200 mL Erlenmeyer flask. The spore suspension was directly treated with HW in a laboratory hot water bath for 30 min at 50 °C and 55 °C, and for 45 min at 40 °C, 45 °C, 50 °C, and 55 °C. The mycelium suspension was prepared by incubating the spore suspension on a shaker at 100 rpm for three days. The control suspension was untreated but remained on the laboratory bench at room temperature (~21 °C) for the duration of the treatment. Following treatment, 10 µL of spore or mycelial suspensions were plated onto 2 % MEA, and the plates were incubated for seven days in the dark at ~21 °C in a cultivation chamber. The number of colony-forming unit (CFU) of the isolates was counted and the treatment efficacy was calculated relative to the control. The experiment was repeated three times with ten replicates/treatments with time-temperature combinations and isolates.

5. Testing pathogen sensitivity to HWT on wood

The sensitivity of P. chlamydospora and P. minimum to HWT at several temperature-time combinations was tested on artificially inoculated sterile wood (Figure 1). Therefore, one-year-old ‘Müller-Thurgau’ dormant cane segments were autoclaved at 121 °C for 30 min. The most virulent isolates (Pch117179, Pmi63194) of each pathogen were selected for testing based on internal laboratory results. The sterile cuttings were vacuum inoculated for 15 min under 2 × 10-3 mbar pressure in a table vacuum apparatus with 700 mL spore suspension/isolate of each species. Following inoculation, the surface of the canes was rinsed with distilled water and the cuttings were treated in a laboratory hot water bath for 30 min at 50 °C and 55 °C, and for 45 min at 40 °C, 45 °C, 50 °C and 55 °C. Treatment was carried out on the day of inoculation or four days after incubation in the dark at ~21 °C to enable colonisation and mycelium development in the cane segments. Control canes were inoculated but not exposed to HWT. Following the incubation period, the cane segments were HWT at the same time-temperature combinations as previously described. The treated cuttings were surface sterilised by flaming, subdivided longitudinally, and plated on 2 % MEA plates. The presence or absence of the fungal pathogens was assessed after seven days of incubation in the dark at ~ 21°C in a cultivation chamber, and the growth rate was calculated relative to the untreated control. The experiment was conducted three times with five replicates per treatment for each tested isolate.

6. Nursery experiment on the effect of HWT on GTD pathogens and T. atroviride SC1

Nursery experiments were carried out to assess the long-term effect of HWT and its influence on the efficacy of Trichoderma (Figure 1). For this purpose, a 600 mL spore suspension of each of the following species was prepared: two combined isolates of P. chlamydospora (Pch117179 and Pch101571) and P. minimum (Pmi117607 and Pmi63194), and one isolate of D. seriata (Dse41). Similarly, a suspension of Vintec® containing T. atroviride SC1 (Ta SC1) was obtained by suspending the formulated granulate in 600 mL tap water (2 g/L; 1010 conidia per gram formulated product) according to the manufacturer’s recommendations. One-year-old ‘Dornfelder’ shoots were collected from the experimental vineyards of DLR Rheinpfalz. One-internode cuttings underwent vacuum inoculation as described above using spore suspensions of the individual GTD pathogens, and in combination with Ta SC1 at a ratio of 1:1. The inoculated cuttings were stored in a cooler at ~2 °C for seven days. HWT and the handling of propagation material was carried out under practical conditions seven days post-inoculation (dpi) at 50 °C for 45 min in a 6,000 L professional hot water tank in March of each experimental year. The material was stored at ~2 °C for four weeks until the grafting process took place. The cuttings were grafted with an Omega-cut on healthy ‘SO4’ rootstock and sealed with paraffin. The grafted plant material was incubated in callusing boxes for two weeks, then planted in the nursery in a randomised block design in May in both experimental years.

Plant foliage protection against powdery and downy mildew infestation and trimming was carried out based on common practice. The planting material was uprooted in November in each experimental year and stored in cold storage wrapped in plastic bags until the last sampling time point. Wood samples were taken directly after HWT (7 dpi), six months post inoculation (mpi) from plants in the nursery, and 12 mpi during the cold storage phase. The bark of the scion cuttings was removed, and samples were taken from three different parts of each cutting. A 0.5 cm wood chip was removed every centimetre starting 1 cm below the top of the scion. The wood chips were surface sterilised by flaming, then cut into four equal-sized fragments. Twelve wood fragments originating from the same cane were plated on the same agar plate containing 2 % MEA supplemented with 0.1 % tetracycline hydrochloride (MEA+TE). The presence of the pathogens was visually assessed after three weeks of incubation in the dark at ~21 °C in a cultivation chamber. The incidence of pathogen infections was calculated from the mean of three sections for each cane. The experiment was carried out in each of two independent experimental years, with a total of 60 replicates per treatment per year, and 20 replicates per sampling time point.

7. DNA extraction from wood samples and real-time PCR

DNA was extracted from ~100 mg wood material using the method described by Pouzoulet et al. (2013). DNA quality was verified via gel electrophoresis and final DNA concentration was measured via NanoDrop 2000 (Thermo Fisher Scientific GmbH, Osterode, Germany). Real-time PCR was performed to detect the fungal pathogens and Ta SC1 in triplicate using reaction mixtures at a total volume of 25 µL and containing 12.5 µL 2 × iTag Universal SYBR Green Supermix Buffer (Bio-Rad Laboratories, Inc., Hercules, USA), and forward and reverse primers at a concentration of 0.3 µM, 10 µL nuclease-free H2O with 1 µL DNA template at a dilution of 1:10 in a Rotor-Gene Q cycler (Qiagen, Hilden, Germany). PCR products were purified using GenepHlow™ Gel/PCR Kit (Geneaid Biotech Ltd., New Taipei City, Taiwan) according to the user manual. Sequencing of PCR products was conducted by Eurofins Genomics GmbH (Ebersberg, Germany). Sequences were edited using the BioEdit Sequence Alignment Editor (version 7.0.5.3) and alignments were processed via Clone Manager 9.2 software.

8. Ta SC1 isolation and identification at the end of the nursery experiment

Identification of Ta SC1 was carried out at the end of each experimental year. Three samples were randomly selected from each Ta SC1 treatment group for molecular analysis. A 0.5 cm segment was removed from the scion 2 cm below the top cut and chopped into thin slices. Amplification of the endochitinase 42 gene was carried out by the forward (Ech42 Fw; 5´- GTTCTGAGGCTGGAAGTTGC -3´) and reverse primer (Ech42 Rv; 5´- ACGCCGTCTACTTCACCAAC -3´) pair designed by Savazzini et al. (2008) and applying the cycling programme described by the authors. Sequence analysis of the amplicons was carried out to identify the presence of the probe (Ech42 P; TACCCCTTCAATCACCAATTGTTAG) specific to the target isolate.

9. Selection of material to evaluate the efficacy of HWT on naturally infected scions

Detection of P. minimum and P. chlamydospora was carried out by the forward and reverse primers according to Pouzoulet et al. (2013), with reaction mixtures containing the same ingredients as listed above. The primer set was designed to target the ß-tubulin gene of D. seriata. Sequence alignment was carried out with Diplodia spp. isolates KARE1632 (NCBI accession no. MN318125.1), BoF99.7 (NCBI accession no. KY701766.1), AKBA8 (NCBI accession no. KX259170.1), and MRHf12 (NCBI accession no. MK388682.1) obtained from the NCBI database. Primer specificity tests were carried out on species that commonly occur in grapevine scion. Therefore, fungal colonies from the strain collection of the Institute of Plant Protection at DLR Rheinpfalz were grown on 2 % MEA; namely, Trichoderma koningiopsis, Trichoderma gamsii, Phomopsis ampelina, Penicillium expansum, Fomitiporia mediterranea, Trichothecium roseum, Botrytis cinerea, Cladosporium herbarum, and Cylindrocarpon destructans (Table S1). DNA extraction from fresh fungal colonies was carried out by scraping off fungal mycelium from two-week-old colonies grown on agar plates using a sterile scalpel. The samples were freeze-dried in liquid nitrogen and homogenised as described previously. DNA extraction was performed by DNeasy plant mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Real-time PCR reactions were prepared as mentioned above using the target-specific primers (Table 2).

Table 2. Primer sequences used in this study to detect D. seriata, P. minimum, and P. chlamydospora.

Target organism

Target gene

Primer name

Primer sequence

(5´-3´)

Product length (bp)

MC* temperature (°C)

Efficiency (%)

R2 Value

Reference

Diplodia spp.

ß-tub

Dse_Tub_41F

GCGAGCACGGCCTG

~70 bp

84.6 ± 0.03

97.4

0.948

This study

Dse_Tub_111R

AGACGTTCATGCGCTCC

P. chlamydospora

ß-tub

PchQF

CTCTGGTGTGTAAGTTCAATCGACTC

72 bp

Pouzoulet et al. (2013)

PchQR

CCATTGTAGCTGTTCCAAGATCAG

P. minimum

ß-tub

PalQF

CGGTGGGGTTTTTACGTCTACAG

96 bp

Pouzoulet et al. (2013)

PalQR

CGTCATCCAAGATGCCGAATAAAG

* Melting curve peak temperature

The PCR programme was run as follows: initial denaturation at 95 °C for 5 min, 35 cycles of 10 s at 95 °C for denaturation, and the extension step at 61 °C for 30 s, followed by the melt curve analysis from 65 °C to 95 °C with 0.5 °C increments at 5 seconds/step. A standard curve was prepared by plotting the average threshold cycle value (Ct values) against the log concentration of the target DNA to estimate the primer efficiency calculated by the software. A dilution series of 5 ng, 500 pg, 50 pg, 5 pg, and 500 fg total fungal DNA extracted from fresh mycelium was thus amplified. Melting curve analysis was carried out by the Rotor-Gene Q Series Software (version 2.0.2.4) with threshold settings at 0.16 dF/dT. Real-time PCR product clean-up and sequencing were carried out as described earlier. NCBI Nucleotide BLAST was used to identify the species of the obtained sequences.

In order to select naturally-infected scion material for the laboratory experiment, an experimental field in DLR Rheinpfalz containing 15 years old ‘Riesling’ plants was tested for the presence of P. minimum, P. chlamydospora, and Diplodia spp. via molecular analysis and re-isolation. Twenty plants were selected for the experiment, of which 10 plants had shown symptoms during the previous vegetative phase. Wood powder samples were taken from the trunk heads by drilling a hole with a hand drill equipped with a 5 mm drill bit in December 2023. DNA extraction was conducted as described above. Additionally, 10 mg of the powder was plated on 2 % MEA + TE for re-isolation in parallel to the molecular analysis. Powder samples plated on agar were incubated for 14 days in the dark at ~21 °C, and the presence of the target pathogen was visually assessed based on morphological traits using a stereomicroscope.

The effect of HWT on Diplodia spp. on naturally infected scion cuttings was assessed (Figure 1). Therefore, four dormant one-year-old shoots were collected from each of the previously tested plants and analysed for pathogen presence. Fifteen positive and 15 negative shoots were used in the experiment, and samples were taken from the first four internodes at the basal and top sections. Approximately 100 mg of drill powder samples were taken from each section. In each trial, five sections per treatment were randomly selected as replications. The experimental setup included both healthy and diseased groups of the non-HWT control and the HWT material. Assessment was carried out via real-time PCR and via re-isolation on 2 % MEA + TE prior to treatment. HWT was carried out in a laboratory water bath at 50 °C for 45 min. Drill samples were taken 24 hours post-HWT directly next to the previous sampling location, and the presence of the pathogen was assessed via real-time PCR and re-isolation.

10. Statistical analysis

A statistical analysis was performed using RStudio software (version 4.3.2, R. Posit Software, PBC, Boston, MA). CFU count data of the in vitro HWT assay was analysed by fitting the data to a negative binomial generalised linear model (GLM). Post hoc pairwise comparisons were conducted to assess the differences between groups using the Šídák method (P ≤ 0.05). Binomial GLM was used to analyse the results of the wood sensitivity test and incidence in the nursery study and field study. To examine the differences in mean values between groups, the ‘emmeans’ package version 1.10.0 was applied using the Šídák or Tukey methods (P ≤ 0.05). To estimate the marginal means of non-zero groups, a linear model was fitted to the data using the ‘lm’ function in RStudio, and the resulting model was then analysed using the ´emmeans´ function. Contrasts were calculated to assess whether the estimated means significantly differed from zero. Model validation was conducted using the DHARMa package (version 0.4.6).

Results

1. In vitro experiment on the sensitivity of fungal spores and mycelium to HWT

The results of HWT on conidial germination of three isolates of P. minimum and P. chlamydospora showed that, in vitro, the tested pathogens survived higher treatment temperatures in their mycelium stage compared to the ungerminated conidia stage (Figure 2). The treatment duration of 30 min did not influence the treatment efficacy at temperatures of 50 °C and 55 °C; all treatments effectively inhibited spore germination of both tested fungal pathogens (Figures 2A and 2B). P. minimum revealed a higher tolerance to HWT compared to P. chlamydospora when subjected to lower temperatures (40 °C and 45 °C). Treatments on P. minimum at the lowest temperature (45 min, 40 °C) did not significantly decrease the number of CFUs of the tested isolates compared to the non-treated control (Figure 2A). For isolates Pmi117607 and Pmi63194, this treatment reached an efficacy of only 5.6 % and 9.0 %, respectively. While this temperature/duration combination had no effect on isolate Pmi9896 (Table 3), the treatment at 45 °C for 45 min reduced the number of CFUs of Pmi117607 significantly (by 60.0 %) when compared to the non-treated control. This treatment showed an efficacy of 32.6 % against Pmi63194 and 53.8 % against Pmi9896. Spore germination of Pmi63194 and Pmi9896 was inhibited at 50 °C. Pmi117607 tolerated 50 °C, but conidial survival at this temperature was negligible (Figure 2A). In the case of P. chlamydospora, treatment at 40 °C of ungerminated spores decreased the conidial survival of Pch101571 by 93.8 %, by 89.5 % of the wild isolate Pch9886 (Figure 2B) and by 62.6 % of Pch117179 compared relative to the non-treated control. The temperatures of 45 °C completely inhibited the spore germination of all the tested P. chlamydospora isolates (Table 3).

Regarding the mycelium developmental stage of P. minimum, Pmi117607 was observed to survive treatment for 30 min at 50 °C, with an efficacy of 98.2 % against the isolate (Figure 2C). The results from the longer treatment durations showed that P. minimum tolerated treatments at 40 °C with a treatment efficacy ranging between 4.9 % and 54.5 % (Table 3). Pmi117607 showed the highest tolerance to HWT at the mycelium stage, since it survived treatments of 50 °C regardless of the duration of the treatment (Figure 2C). A high HWT treatment efficacy was observed against P. chlamydospora mycelium, the lowest being 93.4 % at the lowest tested temperature against Pch101571. With further temperature increase, the number of CFUs of the tested isolates was found to decrease (Figure 2D). Efficacy at 50 °C reached more than 99 % in case of Pch101571 and Pch9886. Temperatures at 55 °C inhibited the growth of all the isolates.

Figure 2. Effects of hot water treatments (HWT) comprising different combinations of temperature and exposure time on the survival of conidia (A, B) and mycelium (C, D) of three isolates of P. minimum and P. chlamydospora (CFU = colony forming unit).
Groups sharing the same letter are considered statistically indistinguishable. Significant differences between treatments were analysed by fitting a negative binomial GLM followed by a Sidak’s post hoc test. Different letters indicate significant differences at P ≤ 0.05 (n = 30).

Table 3. Efficacy (%) of the tested time-temperature combinations of hot water treatment (HWT) against spore and mycelium stages of three isolates of P. minimum and P. chlamydospora.

Treatment

HWT efficacy (%)

P. minimum

P. chlamydospora

Duration (min)

Temperature (°C)

Pmi117607

Pmi63194

Pmi9896

Pch117179

Pch101571

Pch9886

Spore stage

30´

50 °C

100

100

100

100

100

100

55 °C

100

100

100

100

100

100

40 °C

5.6

9.0

0.0

62.6

93.8

89.5

45´

45 °C

60.0

32.6

53.8

100

100

100

50 °C

99.9

100

100

100

100

100

55 °C

100

100

100

100

100

100

Mycelium stage

30´

50 °C

98.2

100

100

100

100

100

55 °C

100

100

100

100

100

100

40 °C

22.6

54.5

4.9

98.0

93.4

98.6

45´

45 °C

99.8

99.1

99.5

99.7

98.6

99.3

50 °C

99.5

99.9

99.9

100

99.9

99.9

55 °C

100

100

100

100

100

100

2. Pathogen sensitivity to HWT on wood

In order to determine the sensitivity of the fungal pathogens to HWT in a more natural matrix – as opposed to in the artificial in vitro laboratory conditions – conidia and mycelium were tested on autoclaved woody cuttings that had undergone vacuum inoculation with a spore suspension of the individual pathogens. HWT was carried out on the day of inoculation or three days later to allow spore germination and mycelium development in the inoculated canes. Because the results of the in vitro study had shown the survival of the two test pathogens at 40 °C, this temperature was excluded from the HWT assays on the detached canes. P. chlamydospora was found to be more sensitive to HWT than P. minimum at all temperature/time combinations (Figure 3). P. minimum conidia germination was not completely inhibited after treatment durations of 30 min. Treatments lasting 30 min at 50 °C showed a 17 % growth rate at the ungerminated spore stage, whereas a 7 % growth rate was detected at the mycelium developmental stage (Figure 3A). Temperatures of 55 °C for 30 min were still not sufficient for the inhibition of spore germination, the growth rate being 3 %. Nonetheless, no pathogen growth was detected when treatment was carried out at the mycelium stage of P. minimum. HWT at 45 °C for 45 min did not prevent spore germination, the growth rate being more than 66 %, and it reduced the growth rate of mycelium development to 27 %. Nonetheless, treatments with a duration of 45 min were effective in completely eliminating P. minimum at 50 °C at each of the different developmental stages. Regarding the results of P. chlamydospora, a shorter treatment duration of 30 min at 50 °C and 55 °C prevented the growth of the pathogen at both developmental stages (Figure 3B). P. chlamydospora showed tolerance to HWT for 45 min at 45 °C, with a 7 % survival rate at the ungerminated spore stage, whereas the mycelium stage showed a higher tolerance to the treatment at that temperature, with a 23 % growth rate. Temperatures at 50 °C for 45 min completely inhibited the growth of P. chlamydospora in detached scion cuttings.

Figure 3. Growth rate of P. minimum (A) and P. chlamydospore (B) following hot water treatment (HWT) at different time-temperature combinations. Sensitivity was tested at the spore (HWT at 0 dpi) and mycelium stages (HWT at 3 dpi after incubation at ~21 °C in the dark).
Different letter above bars indicate significant differences between the treatments according to binomial GLM with post hoc comparison with Sidak’s post hoc test (P ≤ 0.05, n = 30).

3. Nursery experiments

As the previous tests had indicated high HWT efficacy at 50 °C for 45 min, this temperature-treatment combination was selected for further tests in the nursery experiments. None of the tested pathogens had been isolated prior to planting in the experimental year of 2021, whereas contamination of the non-inoculated samples had reached 45 % incidence prior to planting in 2022 (Table 4). Based on morphological characterisation, Diplodia spp. was identified in the contaminated control samples. Over the growing season, the presence of Diplodia spp. in non-inoculated control samples reached 10 % in 2021 and 40 % in 2022. Still, the incidence of the artificially inoculated samples was significantly higher than in non-inoculated control samples. All tested GTD pathogens successfully colonised the wooden cuttings and these pathogens were detectable one-year post-inoculation after all the usual nursery procedures associated with grapevine propagation had been carried out. P. chlamydospora was re-isolated from non-treated cane samples at 7 dpi in more than 70 % of the samples in both experimental years. At the first sampling time point, P. minimum incidence reached 90 % in 2021 and 40 % in 2022. The highest D. seriata incidence on the non-treated control canes was observed at 7 dpi, with 100 % in 2021 and 90 % in 2022. P. chlamydospora incidence throughout the experimental years reached more than 65 %, of P. minimum it exceeded 60 % and D. seriata remained above 35 % at all sampling time points. The application of Ta SC1 resulted in long-lasting inhibition of pathogen growth – as determined by the visual assessment – after cultivation on media. However, in the case of a cane sample inoculated with P. minimum and treated with Ta SC1, an incidence of 5 % was recorded. While no Ta SC1 growth could be observed on the agar plate for this sample, the inoculated pathogen was re-isolated. Following HWT, the incidence of the individual pathogens decreased significantly at the first sampling time point. No pathogen recovery was detectable at 7 dpi in the case of P. chlamydospora and D. seriata, and P minimum incidence reached only 5 %. In general, the treatment was not capable of fully eliminating the targeted pathogens. Throughout the two experimental years, P. chlamydospora was recovered at the last sampling time points. By contrast, D. seriata was entirely eliminated in 2021, and in the following experimental year, it was detected on 10 % of the samples at 6 mpi.

It is worth noting that the incidence of D. seriata in the inoculated HWT samples might have originated from natural infection, as the incidence of non-inoculated samples also increased at this time point (6 mpi in 2022). At the second sampling time point, P. minimum incidence reached 40 %, but no pathogen was detected at 12 mpi in 2021. In 2022, P. minimum incidence after HWT increased from 20 % to 30 % at the last sampling time points of the observation period.

A complete, long-term eradication of all tested pathogens was achieved through the combined treatment of HWT and Trichoderma. Trichoderma growth was not influenced by HWT, and, at the end of the two experimental years, the recovery of the Trichoderma-based BCA product from the wood sections exceeded 95 % (Table S2). The presence of the SC1 strain was confirmed through sequencing, indicating 90 % recovery of Ta SC1 in the treated samples (Table S3).

Table 4. Pathogen incidence (%) of scion cuttings inoculated with the individual pathogens and Ta SC1 and exposed to hot water treatment (HWT) based on visual assessment (data merged from two independent experiments). Different letters indicate significant differences between groups based on binomial GLM followed by Tukey’s post hoc test (P ≤ 0.05, n = 20).

Treatment

Pathogen incidence (%)

1st sampling

2nd sampling

3rd sampling

2021

2022

2021

2022

2021

2022

Non-HWT

Control

0 ± 0a

45 ± 11.4bc

10 ± 6.9b

40 ± 11.2bcd

10 ± 6.9b

40 ± 11.2bcd

Pch

80 ± 9.2c

70 ± 10.5cd

80 ± 9.2c

65 ± 10.9cd

67 ± 16.7bc*

70 ± 10.5cd

Pmi

90 ± 6.9c

40 ± 11.2bc

60 ± 11.2bc

60 ± 11.2cd

75 ± 9.9c

75 ± 9.9d

Dse

100 ± 0c

90 ± 66.9d

65 ± 10.9c

70 ± 10.5d

35 ± 10.9bc

65 ± 10.9cd

Pch + Ta SC1

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

Pmi + Ta SC1

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

5 ± 5b

0 ± 0a

Dse + Ta SC1

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

HWT

Control

0 ± 0a

0 ± 0

10 ± 6.9b

25 ± 9.9bcd

14 ± 9.7b**

15 ± 8.2b

Pch

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

6.7 ± 6.7b

25 ± 9.9bc

Pmi

5 ± 5b

5 ± 5b

40 ± 11.2bc

20 ± 9.2bc

0 ± 0a*

30 ± 10.5bcd

Dse

0 ± 0a

0 ± 0a

0 ± 0a

10 ± 6.9b

0 ± 0a

0 ± 0a

Pch + Ta SC1

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

Pmi + Ta SC1

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a***

0 ± 0a

Dse + Ta SC1

0 ± 0c

0 ± 0a

0 ± 0a

0 ± 0a

0 ± 0a****

0 ± 0a

*n = 9, **n = 14, ***n = 6, ****n = 10

4. HWT of naturally infected shoot material

In order to obtain naturally infected scion material, a 15-year-old Riesling vineyard was tested for the presence of P. minimum, P. chlamydospora and Diplodia spp. According to the results of the real-time PCR assessment, P. minimum was present on the trunks of 14 % of the plants, but pathogen re-isolation was only successful in one sample. In general, P. chlamydospora was present in 73 % of the samples according to the molecular analysis (Table S4), while Diplodia spp. were present in 32 % of the tested plant trunks, which was confirmed by re-isolation on agar plates. Seventeen out of 88 shoots were tested positive for possessing Diplodia spp., which partially originated from mother plants that had not shown any symptoms in the previous vegetative season. The pathogen was detected in the basal first three internodes of the shoots (Table S5). Due to the high incidence of Diplodia spp. in the shoot material, this species was selected as the model pathogen for testing the molecular analysis method for the evaluation of HWT efficacy.

According to the visual assessment of the wood fragments, the percentage of plants infected with Diplodia spp. significantly decreased following HWT at 50 °C for 45 min (Figure 4): pathogen incidence was 20 % in treated plants compared to 93 % in untreated infected plants. The sequence analysis confirmed that it was D. seriata which had been isolated and cultivated from these infected samples. No pathogen presence was detected in the non-treated negative control group, whereas an incidence of 7 % was detected in the HWT group via visual assessment of the wood fragments.

According to the results of the molecular analysis, pathogen incidence in the untreated infected material reached 80 %, with two samples showing an amplification signal, but the melt curve remained below the threshold limit. Diplodia spp. was detected in 53 % of the infected HWT samples one-day post-treatment, with no significant impact of the treatment compared to the non-treated infected group. The incidence of the non-infected control samples treated with HWT was 7 % according to the real-time PCR detection, confirming the observations made on the agar plates. This incidence was reached in one sample colonised by Diplodia mutila, which was verified by sequence analysis.

Figure 4. Incidence (%) of Diplodia spp. in one-year-old cane samples non-treated or exposed to hot water treatment (HWT) grouped as infected (positive) and non-infected (negative) according to visual and molecular (real-time PCR) analysis.
Significant differences are indicated with different letters above the bars based on binomial GLM followed by Tukey’s post hoc test (P ≤ 0.05, n = 15).

Discussion

This study investigated the efficacy of using HWT against several GTD pathogens, and the influence of HWT on the antagonistic ability of Ta SC1. In order to assess the sensitivity of different isolates to HWT, pathogenic isolates of diverse origin (from German grapevine growing areas, as well as from Italy and South Africa) were selected and tested in vitro. The survival of P. minimum conidia was observed following HWT at 50 °C for 45 min, whereas P. chlamydospora conidia had already been killed by 45 °C. Gramaje et al. (2008) had similarly reported the higher sensitivity of P. chlamydospora to HWT compared to P. minimum, confirming the present findings. In the present study, no significant differences between individual isolates of one fungal species were observed with regard to HWT efficacy. However, a previous study has shown that in the case of isolates originating from southern vine-growing regions a higher temperature was required to inhibit pathogen growth. In that study, the inhibition of conidial germination of P. chlamydospora required temperatures of 53 °C, whereas complete elimination of P. minimum was achieved following treatments at 54 °C (Gramaje et al., 2008). In the present study, the sensitivity results of the two distinct developmental stages indicate that both pathogens have a high temperature tolerance at the mycelium stage. HWT at 40 °C showed no or only poor efficacy against isolates of P. minimum, and colony formation of the pathogen was detected following treatment at 50 °C regardless of the treatment duration. In the case of P. chlamydospora, HWT on the mycelium reached an efficacy of more than 90 % at 40 °C and 45 °C, and survival of the pathogen was still observed at 50 °C.

The survival of P. minimum and P. chlamydospora observed after treatment at 50 °C are consistent with the findings of Gramaje et al. (2008) and Whiting et al. (2001), who reported that HWT at 50 °C is not sufficient for the elimination of these GTD pathogens. It is important to mention that HWT above 50 °C for grapevine varieties grown in cooler wine-producing areas is limited due to the higher sensitivity of the planting material to heat stress, leading to increased graft failure and loss of vitality (Waite & Morton, 2007). Additionally, the present findings indicate that the duration of a treatment has less impact on its efficacy than temperature, since treatments lasting 30 min at 50 °C were already able to inhibit germination of P. chlamydospora and P. minimum conidia in vitro. Similarly, Whiting et al. (2001) found no conidia germination of P. chlamydospora following treatment at 51 °C for 15 min. In contrast, the present study indicated that in detached canes artificially inoculated with P. chlamydospora and P. minimum, 30-min treatments at 50 °C did not inhibit germination of P. minimum, but 45 min at 50 °C was sufficient for the elimination of both tested pathogens in scion cuttings.

Based on these results, no initial infection of P. minimum was expected in the nursery experiment, but survival of the pathogen was nonetheless recorded at the first sampling time point in both experimental years. This difference is most likely due to the different grapevine varieties tested in the two experiments, since the diameter of ‘Dornfelder’ cuttings is, on average, larger than that of ‘Müller-Thurgau’, which may have reduced the ability of heat to penetrate the wood tissue, thereby better protecting fungal structures. However, further studies should be undertaken to confirm whether the efficacy of HWT depends on the diameter of the wood material of diverse grapevine cultivars. The results of the nursery experiment showed that HWT on scion cuttings inoculated with P. chlamydospora and P. minimum was effective in significantly reducing pathogen incidence. Nonetheless, re-isolation of the target pathogens occurred at several time points in the two experimental years, suggesting a partial survival of the pathogens after HWT. This points to the inability of HWT to provide long-term protection for planting material, which is consistent with previous findings (Crous et al., 2001; Gramaje et al., 2009).

Similarly, Diploda spp. recovered after six months in the second experimental year. It is worth noting that a high abundance of Diploda spp. occurred in non-inoculated control samples in 2022, indicating its presence in the planting material before the propagation process had begun. Recent studies have investigated potential inoculum sources of the Botryosphaeriaceae species in commercial nurseries, finding high infection rates by Neofusicoccum luteum, Neofusicoccum parvum, D. mutila, and D. seriata in mother plants (Billones-Baaijens et al., 2013; Spagnolo et al., 2011), as well as in rootstock tissues (Gramaje et al., 2022). This may explain the high contamination level of planting material with Diploda spp. in the present study.

A study by Fischer and Kassemeyer (2003) on trunk samples collected from grapevines from established vineyards confirmed that D. seriata is one of the most commonly occurring GTD pathogens in Germany (Fischer & Kassemeyer, 2003). Thirty-two percent of the tested plants were infected with the pathogen, and more than 5 % of the tested one-year-old shoots were infected with Diplodia spp., which, moreover, colonised the base of the shoots in an asymptomatic manner. Kraus et al. (2019) studied the endophytic fungal community of healthy grapevine shoots and found D. seriata to be the most frequently isolated GTD pathogen in young shoots of up to two months old, whereas P. chlamydospora was only detected in perennial grapevine branches of up to one-year-old.

The DNA analysis of HWT wood material revealed that viable and non-viable pathogens were not distinguishable by real-time PCR when samples were taken 24 hours post-treatment. To identify viable pathogens by molecular methods, RNA extraction with subsequent RT-qPCR was performed. However, both the amount and quality of RNA extracted from woody material was unsatisfactory and pathogen detection unreliable (data not shown), hence this method was not further applied. Therefore, the most reliable method for disease assessment after HWT remains the isolation of pathogens on agar plates followed by visual assessment.

The present results revealed that HWT significantly reduced the incidence of scion cuttings naturally infected with D. seriata. Based on the results of the nursery experiment, treatment at 50 °C for 45 min of D. seriata inoculated cuttings showed complete eradication of the pathogen at 7 dpi in both experimental years. Previous studies from New Zealand showed less than 4 % survival of D. seriata mycelium plugs when treated in vitro for 45 min at 50 °C. Moreover, a high reduction in the vitality of several Botryosphaeriaceae pathogens was observed following HWT of artificially inoculated canes at 50 °C for 30 min (Elena et al., 2015), thus indicating a high sensitivity of the pathogen to HWT, which is similar to the present Diplodia spp. observations.

Overall, these findings confirm that HWT efficacy is strongly dependent on the targeted pathogens, and that when applied alone it does not provide the treated planting material with sufficient long-term protection from re-infection. However, the results from the nursery experiment indicate that a combined treatment of HWT and Ta SC1 application may successfully prevent recovery of the pathogens at any of the tested time points. Previous studies have already shown the high biological activity of Trichoderma spp. against GTD pathogens (Del Pilar Martínez-Diz et al., 2021; Di Marco & Osti, 2007; Di Marco et al., 2004; Úrbez-Torres et al., 2020; van Jaarsveld et al., 2020). While the commercial product containing T. harzianum (TrichoFlow-T™) tested in nursery experiments reduced the incidence of several GTD pathogens (Fourie & Halleen, 2006), the same product tested again by Halleen and Fourie (2016) displayed only poor efficacy. It is worth noting that, in the latter study, the re-isolation rate of T. harzianum varied between three and nine percent after drench application. By contrast, in the present study, the biocontrol agent containing Ta SC1 was re-isolated from nearly every sample following vacuum inoculation. Together with the results of the sequence analysis, which confirmed the presence of Ta SC1, our results verify the high potential of the strain to colonise grapevine canes. These findings are in line with those of Berbegal et al. (2020), who reported an 80 % re-isolation rate of Ta SC1 from rootstock planting material at the end of the growing season following soaking treatments. This all suggests the higher ability of Ta SC1 to colonise the wood tissue of grapevine compared to T. harzianum. In the present study, this ability might have been promoted by the applied vacuum inoculation method, allowing conidia to enter the vessels of the planting material. Moreover, HWT had no adverse effects on the antagonist ability of Ta SC1 when it colonised the wood of the planting material prior to the heat treatment. This indicates that flexible BCA application can be combined with HWT in an integrated management approach during the propagation process.

Conclusion

The results of the present study indicate that HWT at 50 °C for 45 min or Ta SC1 application alone were insufficient for full elimination of GTD pathogens. However, the combined treatment significantly reduced pathogen incidence and provided long-lasting protection by Ta SC1 of the graft unions in the nurseries during the 12-month observation period. Additionally, the low sensitivity of Ta SC1 to HWT was shown to enable a flexible sequence of treatments during the propagation process. This study highlights the potential of applying combined HWT and Ta SC1 treatments in the production of grapevine planting material to improve its phytosanitary quality.

Acknowledgements

This research was financially supported by the Forschungsring des Deutschen Weinbaus (FDW) at the Deutsche Landwirtschafts-Gesellschaft (DLG e.V.). The authors thank Maja Kube, Helena Becker and Jens Holzhauser for the technical support.

References

  • Aroca, Á., Gramaje, D., Armengol, J., García-Jiménez, J., & Raposo, R. (2010). Evaluation of the grapevine nursery propagation process as a source of Phaeoacremonium spp. and Phaeomoniella chlamydospora and occurrence of trunk disease pathogens in rootstock mother vines in Spain. European Journal of Plant Pathology, 126, 165-174. https://doi.org/10.1007/s10658-009-9530-3
  • Berbegal, M., Ramón‐Albalat, A., León, M., & Armengol, J. (2020). Evaluation of long‐term protection from nursery to vineyard provided by Trichoderma atroviride SC1 against fungal grapevine trunk pathogens. Pest Management Science, 76(3), 967–977. https://doi.org/10.1002/ps.5605
  • Bertsch, C., Ramírez-Suero, M., Magnin-Robert, M., Larignon, P., Chong, J., Abou-Mansour, E., Spagnolo, A., Clément, C., & Fontaine, F. (2013). Grapevine trunk diseases: complex and still poorly understood. Plant Pathology, 62(2), 243–265. https://doi.org/10.1111/j.1365-3059.2012.02674.x
  • Billones-Baaijens, R., Rirdgway, H. J., Jones, E. E., & Jaspers, M. (2013). Inoculum sources of Botryosphaeriaceae species in New Zealand grapevine nurseries. European Journal of Plant Pathology, 135(1), 159–174. https://doi.org/10.1007/s10658-012-0075-5
  • Bleach, C., Jones, E., Ridgway, H., & Jaspers, M. (2013). Hot water treatment to reduce incidence of black foot pathogens in young grapevines grown in cool climates. Phytopathologia Mediterranea, 52, 347–358. https://www.jstor.org/stable/42685412
  • Crous, P. W., Gams, W., Wingfield, M. J., & van Wyk, P. S. (1996). Phaeoacremonium gen. Nov. associated with wilt and decline diseases of woody hosts and human infections. Mycologia, 88(5), 786–796. https://doi.org/10.1080/00275514.1996.12026716
  • Crous, P. W., & Gams, W. (2000). Phaeomoniella chlamydospora Gen. et Comb. Nov., a causal organism of Petri grapevine decline and Esca. Phytopathologia Mediterranea, 39, 112–118. https://www.jstor.org/stable/26456536
  • Crous, P. W., Swart, L., & Coertze, S. (2001). The effect of hot-water treatment on fungi occurring in apparently healthy grapevine cuttings. Phytopathologia Mediterranea, 40, S464–S466. https://www.jstor.org/stable/44981659
  • Del Pilar Martínez-Diz, M., Díaz-Losada, E., Andrés-Sodupe, M., Bujanda, R., Maldonado-González, M. M., Ojeda, S., Yacoub, A., Rey, P., & Gramaje, D. (2021). Field evaluation of biocontrol agents against black-foot and Petri diseases of grapevine. Pest Management Science, 77(2), 697–708. https://doi.org/10.1002/ps.6064
  • Di Marco, S., Osti, F., & Cesari, A. (2004). Experiments on the control of Esca by Thricoderma. Phytopathologia Mediterranea, 43, 108–115. https://doi.org/10.36253/phyto-5040
  • Di Marco, S., & Osti, F. (2007). Application of Trichoderma to prevent Phaeomoniella chlamydospora infections in organic nurseries. Phytopathologia Mediterranea, 46(1), 73-83. https://doi.org/10.36253/phyto-5204
  • Di Marco, S., Metruccio, E. G., Moretti, S., Nocentini, M., Carella, G., Pacetti, A., Battiston, E., Osti, F., & Mugnai, L. (2021). Activity of Trichoderma asperellum strain ICC 012 and Trichoderma gamsii strain ICC 080 toward diseases of esca complex and associated pathogens. Frontiers in Microbiology, 12, 813410. https://doi.org/10.3389/fmicb.2021.813410
  • Elena, G., Di Bella, V., Armengol, J., & Luque, J. (2015). Viability of Botryosphaeriaceae species pathogenic to grapevine after hot water treatment. Phytopathologia Mediterranea, 54, 325–334. http://dx.doi.org/10.14601/Phytopathol_Mediterr-15526
  • Fischer, M. (2006). Biodiversity and geographic distribution of Basidiomycetes causing esca-associates white rot in grapevine: a worldwide perspective. Phytopathologia Mediterranea, 45(1), 30–42. https://www.jstor.org/stable/26463234
  • Fischer, M., & Kassemeyer, H.‑H. (2003). Fungi associated with Esca disease of grapevine in Germany. Vitis, 42(3), 109–116. https://doi.org/10.5073/vitis.2003.42.109-116
  • Fischer, M., & Peighami, A. S. (2019). Grapevine, esca complex, and environment: the disease triangle. Phytopathologia Mediterranea, 58(1), 17–37. https://www.jstor.org/stable/26675720
  • Fourie, P., Halleen, F., van der Vyver, J., & Schreuder, W. (2001). Effects of Trichoderma treatments on the occurrence of decline pathogens in the roots and rootstocks of nursery grapevines. Phytopathologia Mediterranea, 40(3), S473–S478. https://www.jstor.org/stable/44981661
  • Fourie, P. H., & Halleen, F. (2004). Occurrence of grapevine trunk disease pathogens in rootstock mother plants in South Africa. Australasian Plant Pathology, 33(2), 313. https://doi.org/10.1071/AP04005
  • Fourie, P. H., & Halleen, F. (2006). Chemical and biological protection of grapevine propagation material from trunk disease pathogens. European Journal of Plant Pathology, 116(4), 255–265. https://doi.org/10.1007/s10658-006-9057-9
  • Gramaje, D., García-Jiménez, J., & Armengol, J. (2008). Sensitivity of Petri disease pathogens to hot-water treatments in vitro. Annals of Applied Biology, 153(1), 95–103. https://doi.org/10.1111/j.1744-7348.2008.00229.x
  • Gramaje, D., Armengol, J., Salazar, D., López-Cortés, I., & García-Jiménez, J. (2009). Effect of hot-water treatments above 50°C on grapevine viability and survival of Petri disease pathogens. Crop Protection, 28(3), 280–285. https://doi.org/10.1016/j.cropro.2008.11.002
  • Gramaje, D., Alaniz, S., Abad-Campos, P., García-Jiménez, J., & Armengol, J. (2010). Effect of hot-water treatments in vitro on conidial germination and mycelial growth of grapevine trunk pathogens. Annals of Applied Biology, 156(2), 231–241. https://doi.org/10.1111/j.1744-7348.2009.00382.x
  • Gramaje, D., & Armengol, J. (2011). Fungal trunk pathogens in the grapevine propagation process: potential inoculum sources, detection, identification, and management strategies. Plant Disease, 95(9), 1040–1056. https://doi.org/10.1094/PDIS-01-11-0025
  • Gramaje, D., Mostert, L., & Armengol, J. (2011). Characterization of Cadophora luteo-olivacea and C. melinii isolates obtained from grapevines and environmental samples from grapevine nurseries in Spain. Phytopathologia Mediterranea, 50, 112–126. http://www.jstor.org/stable/26458715
  • Gramaje, D., Úrbez-Torres, J. R., & Sosnowski, M. R. (2018). Managing Grapevine Trunk Diseases with respect to etiology and epidemiology: current strategies and future prospects. Plant Disease, 102(1), 12–39. https://doi.org/10.1094/PDIS-04-17-0512-FE
  • Gramaje, D., Eichmeier, A., Spetik, M., Carbone, M. J., Bujanda, R., Vallance, J., & Rey, P. (2022). Exploring the temporal dynamics of the fungal microbiome in rootstocks, the lesser-known half of the grapevine crop. Journal of Fungi, 8, 421. https://doi.org/10.3390/jof8050421
  • Halleen, F., Fourie, P. H., & Crous, P. W. (2007). Control of black foot disease in grapevine nurseries. Plant Pathology, 56(4), 637-645. https://doi.org/10.1111/j.1365-3059.2007.01613.x
  • Halleen, F., & Fourie, P. H. (2016). An integrated strategy for the proactive management of Grapevine Trunk Disease pathogen infections in grapevine nurseries. South African Journal of Enology and Viticulture, 37(2), 104-114. https://doi.org/10.21548/37-2-825
  • Harman, G. E. (2006). Overview of mechanisms and uses of Trichoderma spp. Phytopathology, 96(2), 190–194. https://doi.org/10.1094/PHYTO-96-0190
  • Kotze, C., van Niekerk, J., Mostert, L., Halleen, F., & Fourie, P. (2011). Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection. Phytopathologia Mediterranea, 50, S247−S263. https://www.jstor.org/stable/26458725
  • Kraus, C., Voegele, R. T., & Fischer, M. (2019). Temporal development of the culturable, endophytic fungal community in healthy grapevine branches and occurrence of GTD-associated fungi. Microbial Ecology, 77(4), 866–876. https://doi.org/10.1007/s00248-018-1280-3
  • Larignon, P., & Dubos, B. (1997). Fungi associated with esca disease in grapevine. European Journal of Plant Pathology, 103, 147–157. https://doi.org/10.1023/A:1008638409410
  • Larignon, P., & Dubos, B. (2000). Preliminary studies on the biology of Phaeoacremonium. Phytopathologia Mediterranea, 39, 184–189. https://www.jstor.org/stable/26456545
  • Laukart, N., Edwards, J., Pascoe, I. G., & Nguyen, N. K. (2001). Curative treatments trialed on young grapevines infected with Phaeomoniella chlamydospora. Phytopathologia Mediterranea, 40, S459–S463. https://www.jstor.org/stable/44981658
  • Leal, C., Richet, N., Guise, J.‑F., Gramaje, D., Armengol, J., Fontaine, F., & Trotel-Aziz, P. (2021). Cultivar contributes to the beneficial effects of Bacillus subtilis PTA-271 and Trichoderma atroviride SC1 to protect grapevine against Neofusicoccum parvum. Frontiers in Microbiology, 12, 726132. https://doi.org/10.3389/fmicb.2021.726132
  • Leal, C., Gramaje, D., Fontaine, F., Richet, N., Trotel-Aziz, P., & Armengol, J. (2023). Evaluation of Bacillus subtilis PTA-271 and Trichoderma atroviride SC1 to control Botryosphaeria dieback and black-foot pathogens in grapevine propagation material. Pest Management Science, 79(5), 1674–1683. https://doi.org/10.1002/ps.7339
  • Mugnai, L., Graniti, A., & Surico, G. (1999). Esca (Black Measles) and Brown Wood-Streaking: two old and elusive diseases of grapevines. Plant Disease, 83(5), 404–418. https://doi.org/10.1094/PDIS.1999.83.5.404
  • Mutawila, C., Fourie, P. H., Halleen, F., & Mostert, L. (2011). Grapevine cultivar variation to pruning wound protection by Trichoderma species against trunk pathogens. Phytopathologia Mediterranea, 50, S264-S276. http://www.jstor.org/stable/26458726
  • Pouzoulet, J., Mailhac, N., Couderc, C., Besson, X., Daydé, J., Lummerzheim, M., & Jacques, A. (2013). A method to detect and quantify Phaeomoniella chlamydospora and Phaeoacremonium aleophilum DNA in grapevine-wood samples. Applied Microbiology and Biotechnology, 97(23), 10163–10175. https://doi.org/10.1007/s00253-013-5299-6
  • Rooney, S. N., & Gubler, D. W. (2001). Effect of hot water treatments on eradication of Phaeomoniella chlamydospora and Phaeoacremonium inflatipes from dormant grapevine wood. Phytopathologia Mediterranea, 40, S467–S472. https://www.jstor.org/stable/44981660
  • Savazzini, F., Longa, C. M. O., Pertot, I., & Gessler, C. (2008). Real-time PCR for detection and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil. Journal of Microbiological Methods, 73(2), 185–194. https://doi.org/10.1016/j.mimet.2008.02.004
  • Spagnolo, A., Marchi, G., Peduto, F., Phillips, A. J. L., & Surico, G. (2011). Detection of Botryosphaeriaceae species within grapevine woody tissues by nested PCR, with particular emphasis on the Neofusicoccum parvum/ N. ribis complex. European Journal of Plant Pathology, 129(3), 485–500. https://doi.org/10.1007/s10658-010-9715-9
  • Úrbez-Torres, J. R., Bruez, E., Hurtado, J., & Gubler, W. D. (2010). Effect of temperature on conidial germination of Botryosphaeriaceae species infecting grapevines. Plant Disease, 94(12), 1476–1484. https://doi.org/10.1094/PDIS-06-10-0423
  • Úrbez-Torres, J. R., Peduto, F., Striegler, R. K., Urrea-Romero, K. E., Rupe, J. C., Cartwright, R. D., & Gubler, W. D. (2012). Characterization of fungal pathogens associated with grapevine trunk diseases in Arkansas and Missouri. Fungal Diversity, 52(1), 169–189. https://doi.org/10.1007/s13225-011-0110-4
  • Úrbez-Torres, J. R., Tomaselli, E., Pollard-Flamand, J., Boulé, J., Gerin, D., & Pollastro, S. (2020). Characterization of Trichoderma isolates from southern Italy, and their potential biocontrol activity against grapevine trunk disease fungi. Phytopathologia Mediterranea, 59, 425–439. https://www.jstor.org/stable/27015434
  • van Jaarsveld, W. J., Halleen, F., & Mostert, L. (2020). In vitro screening of Trichoderma isolates for biocontrol of black foot disease pathogens. Phytopathologia Mediterranea, 59(3), 465–471. https://doi.org/10.14601/Phyto-11173
  • Waite, H., & May, P. (2005). The effects of hot water treatment, hydration and order of nursery operations on cuttings of Vitis vinifera cultivars. Phytopathologia Mediterranea, 44, 144–152. https://www.jstor.org/stable/26463197
  • Waite, H., & Morton, L. (2007). Hot water treatment, trunk diseases and other critical factors in the production of high-quality grapevine planting material. Phytopathologia Mediterranea, 46, 5–17. https://www.jstor.org/stable/26463266
  • Whiting, E. C., Khan, A., & Gubler, W. D. (2001). Effect of temperature and water potential on survival and mycelial growth of Phaeomoniella chlamydospora and Phaeoacremonium spp. Plant Disease, 85(195-201). https://doi.org/10.1094/PDIS.2001.85.2.195

Authors


Dorottya Agnes Simon

dorottyaagnes.simon@dlr.rlp.de

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany / Georg-August-University of Göttingen, Plant Pathology and Crop Protection Section, 37077 Göttingen, Germany

Country : Germany


Patrick Winterhagen

https://orcid.org/0000-0001-7835-8932

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany

Country : Germany


Ruth Walter

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany

Country : Germany


Thierry Wetzel

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany

Country : Germany


Andreas Kortekamp

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany

Country : Germany


Andreas von Tiedemann

Affiliation : Georg-August-University of Göttingen, Plant Pathology and Crop Protection Section, 37077 Göttingen, Germany

Country : Germany


Joachim Eder

Affiliation : State Education and Research Center of Viticulture, Horticulture and Rural Development Rheinpfalz, Institute of Plant Protection, 67435 Neustadt a.d. Weinstraße, Germany

Country : Germany

Attachments

8385_suppdata1_Simon.xlsx Download

Article statistics

Views: 1510

Downloads

XML: 61

Citations

PlumX