Influence of succinic acid on Oenococcus oeni and malolactic fermentation
Abstract
Introduction
Alcoholic fermentation (AF) is the main microbiological process in winemaking, as it converts grape must into wine. This fermentation is carried out by the yeast Saccharomyces cerevisiae, although during the early stages, non-Saccharomyces yeasts are present in the fermenting must (Fleet et al., 1984). There is an increasing interest in these other yeasts (Padilla et al., 2016) due to the production of new aromas (Belda et al., 2017).
The yeast metabolism and the winemaking conditions greatly influence the final composition of the wine. Some compounds produced by yeasts—including non-Saccharomyces—during AF have a large impact on the subsequent malolactic fermentation (MLF), carried out mainly by the lactic acid bacterium Oenococcus oeni (Lonvaud‐Funel, 1999; Bartowsky, 2005; Balmaseda et al., 2018; Ferrando et al., 2020; Balmaseda et al., 2021). Some of these compounds are produced by the primary metabolism of yeast, such as ethanol and SO2 (Arnink and Henick-Kling, 2005), certain organic acids (Lonvaud-Funel and Strasser de Saad, 1982), and medium-chain fatty acids (Guilloux-Benatier et al., 1998; Lonvaud‐Funel et al., 1988). Other compounds are delivered by the secondary metabolism as antimicrobial peptides (Branco et al., 2014) and proteinaceous compounds (Osborne and Edwards, 2007). Among the organic acids derived from the yeast metabolism, succinic acid seems to be the most related to MLF inhibition (Caridi and Corte, 1997; Son et al., 2009).
Succinic acid is one of the relevant organic acids in wine, whose main role is to confer microbial stability to wines in relation to acidity and pH. They also preserve the colour and sensory properties of wines. Tartaric and malic acids are generally the most prominent acids in wines, while others such as acetic, succinic, citric, lactic, and pyruvic can exist in minor concentrations (Mendes-Ferreira and Mendes-Faia, 2020). Tartaric and malic acids are already present in grape must, but no succinic or lactic acids are found in grapes. Instead, succinic acid is usually the predominant non-volatile organic acid formed by yeasts during AF (Thoukis et al., 1965).
Succinic acid is the 1,4-butanedioic acid (HOOC-CH2-CH2-COOH), with an m.w. of 118 g/mol and pKa1 of 4.2 and pKa2 of 5.6 (ChemIDplus, 2021). Its structure is like that of malic acid (HOOC-CHOH- CH2-COOH), which has an m.w. of 134 g/mol, and which can also be called hydroxysuccinic acid. The organoleptic threshold of succinic acid in wine is 35 mg/L. It has an unusual bitter-salty taste and excess levels can have a negative impact on the mouthfeel of the wines (Coulter et al., 2004); thus, it may be beneficial to reduce it.
Succinic acid is an intermediate of the tricarboxylic acid cycle (TCA), and it, therefore, is produced by yeasts during the AF in the early fermentation stages (Conway and Brady, 1950), but also during the stationary phase (Lamikanra, 1997; Arikawa et al., 1999). However, it acts as an intermediary in other metabolic pathways such as γ-amino butyric acid (GABA) bypass, glyoxylic acid bypass and the methylcitric acid cycle. Therefore, due to mechanical stimuli and maceration of red grapes, the GABA concentration in must can increase and could encourage yeast to produce succinic acid (De Klerk, 2010).
S. cerevisiae strains are known to produce succinic acid, with values from 200 mg/L to more than 1 g/L (Heerde and Radler, 1978; Coulter et al., 2004; De Klerk, 2010; Zhu et al., 2020), thus explaining the increases of this acid in winemaking. This production of succinic acid can influence MLF, which has been shown with a cryotolerant S. cerevisiae strain that inhibits MLF (Caridi and Corte, 1997; Son et al., 2009). This organic acid has been described as a possible competitive inhibitor of MLF due to its similarity with L-malic acid (Lonvaud‐Funel et al., 1988; Caridi and Corte, 1997).
In addition, non-Saccharomyces yeasts can also significantly produce succinic acid. For example, Ciani and Maccarelli (1998) found that strains of Torulaspora delbrueckii produced it within the range of 0.3 to 0.8 g/L. Moreover, in sequential fermentation of S. cerevisiae – T. delbrueckii, succinic acid was produced up to 0.95 g/L (Zhu et al., 2020). Moreover, Contreras et al. (2014) found productions of 1 to 2 g/L of this acid by strains of Metschnikowia pulcherrima, Schizosaccharomyces malidevorans and Candida stellata.
Besides the above-mentioned studies of MLF inhibition by succinic-producing yeasts, the influence of succinic acid per se upon MLF and on O. oeni has been studied very little (Lonvaud-Funel and Strasser de Saad, 1982). Interestingly, it seems that succinic acid concentration can decrease during MLF (Yilmaz and Gökmen, 2021) and especially in induced simultaneous MLF with AF (Taniasuri et al., 2016). Consequently, its real influence on MLF remains unclear. Due to the lack of information and to clarify the impact of this compound in winemaking conditions, the main aim of this work was to evaluate for the first time the effect of different succinic acid concentrations on O. oeni strains in MLF. Keeping in mind the different dissociated or undissociated forms of succinic acid in the function of pH, assays at different pH—3.5 and 4.0—were included in the evaluation of the impact of succinic acid. To better understand the physiological response to succinic acid, the gene expressions related to stress and malolactic activity were also analysed.
Materials and methods
1. Strains and culture conditions
Four strains of Oenococcus oeni of diverse origins were initially used: VP41 (Lalvin VP41) from Lallemand Inc. (Montréal, Canada); 1Pw13 (CECT 8893) from our own collection; PSU-1 (ATCC BAA-331), a reference strain with the genome fully annotated; and CH11 (Viniflora CH11), from Chr. Hansen Holding A/S (Hoersholm, Denmark). Before the fermentation assays, cells of these strains were precultured at 28 ºC in an incubator with 10 % (v/v) CO2 in MRS broth supplemented with D, L-malic acid (4 g/L) and fructose (5 g/L) at pH 5.0 for 72 h at least two times prior to experimental use.
2. Influence of succinic acid concentration on the growth of O. oeni strains
In order to see the influence on O. oeni growth, the above-mentioned precultures in supplemented MRS broth were also assayed with three different succinic acid concentrations (0.5, 1 and 2 g/L), and bacterial populations were quantified indirectly by measuring the Abs at 600 nm in a spectrophotometer Polarstar Omega (Biogen, Madrid, Spain).
3. Malolactic fermentation assays with the addition of succinic acid
MLF were carried out in wine-like media (WLM) (Bordas et al., 2013) containing 2 g/L of L-malic acid, 12 % (v/v) ethanol, and three different succinic acid concentrations (0.5, 1 and 2 g/L), as well as the control without succinic acid, at pH 3.5 and 4.0, adjusted with NaOH 1N. All fermentations were performed in triplicate in 250 mL bottles at 20 ºC, inoculated with O. oeni strains at 2 × 107 CFU/mL. The samples were taken every 24 h to evaluate the L-malic acid consumption using an enzymatic kit (BioSystems, Barcelona, Spain) and the cells were harvested by centrifugation (6000 × g, 10 min). They were then frozen in liquid nitrogen and kept at –80 ºC until the RNA extraction.
4. MLF assays with different proportions of L-malic and succinic acids
To evaluate the influence of the ratio of the two acids on MLF, experiments were carried out in WLM with different concentrations of L-malic acid (0.5, 1, 2 and 3 g/L) and succinic acid (0.5, 1 and 2 g/L). All assays were carried out at pH 3.5 and 4.0, at 20 ºC. Control assays without succinic acid were included for each L-malic acid concentration. All experiments were performed in 50 mL Falcon tubes inoculated with 2 × 107 CFU/mL. O. oeni and samples were taken every 24 h to evaluate L-malic consumption using an enzymatic kit (BioSystems).
5. Experiments with resting cells
O. oeni cells were grown in 250 mL of MRS broth at 28 ºC to the early stationary phase. They were then harvested by centrifugation at 6000 × g for 5 min at room temperature, following Mira de Orduña et al. (2000). Cells were resuspended in resting-cell buffer, which contained per litre of deionised water 7.5 g tartaric acid and 1 mL of a mineral solution with 200 g/L MgSO4·7H2O and 50 g/L MnSO2·4H2O). Then, resting cells were transferred to 50 mL Falcon tubes containing 2 g/L of L-malic acid (control assay) and 12 % (v/v) of ethanol. The other conditions had the same molar amount of 2 g/L of L-malic acid (14.9 mM) and different proportional molar succinic acid concentrations (3.7 mM, 7.4 mM, 14.9 mM and 29.8 mM) at pH 3.5 and 4.2. This last pH was chosen because it is the pKa1 for succinic acid. The Falcon tubes were placed in a water bath at 25 ºC and stirred gently. Samples were taken periodically and centrifuged at 6000 g for 5 min and the supernatants were kept at 4 ºC until the L-malic was analysed with an enzymatic kit (BioSystems).
6. Analysis of gene expression
The O. oeni RNA extractions were performed as described by Chomczynski and Sacchi (2006) and then purified with a Roche RNeasy kit according to the manufacturer’s instructions (Roche Diagnostics GmbH, Mannheim, Germany).
cDNA was synthesised from RNA (10 ng/μL) using TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA) as recommended. To analyse the expression of four genes related to stress and malolactic activity, four pairs of primers (Table 1) were taken from previous works (Beltramo et al., 2006; Desroche et al., 2005; Olguín et al., 2010). They were about 18-22 bp long, contained 50 % G/C and had a melting temperature (TM) above 60 ºC. The O. oeni gyrA and gyrB genes were used as housekeeping genes (internal control), using the primers described by Desroche et al. (2005).
Real-time qPCR was performed following Olguín et al. (2010) using a QuantStudio 5 real-time PCR instrument (Thermo Fisher). The results were analysed using the comparative critical threshold (ΔΔCT) method in which the amount of target RNA was adjusted to a reference (internal target RNA) described by Livak and Schmittgen (2001). The relative expression value (RE) was calculated using the Ct values of gyrA and gyrB and the result is the mean of the two results. The analysis was made from biologically duplicated independent assays and for each sample technical triplicates were analysed by qPCR.
7. Chemical analyses
The organic acid contents (acetic, citric, succinic, L-malic and L-lactic acids) in the final samples of MLF trials were determined by high-performance liquid chromatography (HPLC) following Zhu et al. (2020). All samples were filtered previously by injecting them through 0.2 μm Captiva filters (Agilent Technologies). The chromatograms were analysed using the Agilent ChemStation Plus software.
8. Statistical analyses
The data obtained were submitted to one-way ANOVA using the Tukey test, with a confidence interval of 95 %, obtaining significant results with a p-value of ≤ 0.05, using the XLSTAT 2021 software (Addinsoft, Paris, France).
Table 1. Gene description and primer sequences used in this work.
Target gene |
Description |
Forward primer (5´→ 3´) |
Reverse primer (5´→ 3´) |
Amplicon length (bp) |
Reference |
|---|---|---|---|---|---|
gyrA |
Gyrase subunit A |
CGCCCGACAAACCGCATAAA |
CAAGGACTCATAGATTGCCGAA |
95 |
|
gyrB |
Gyrase subunit B |
GAGGATGTCCGAGAAGGAATTA |
GCCTGCTGGGCATCTGTATTA |
107 |
|
mleP |
Malate permease |
GTGCTGACTTATTTGACCCGC |
ATGTTCCACGACGACCAACC |
141 |
|
mleA |
Malolactic enzyme |
CCGACAATTGCTGATACAATTGAA |
GGCATCAGAAACGACCAGCAG |
156 |
|
hsp18 |
Heat shock protein |
CGGTATCAGGAGTTTTGAGTTC |
CGTAGTAACTGCGGGAGTAATTC |
102 |
|
atpB |
ATPase F1 F0 β-subunit |
ATACTGATCCGGCTCCGGC |
CAGCGGGATAAATACCTTG |
93 |
Results and discussion
1. Effect of succinic acid on cells growth
To see the effect of succinic acid concentration on the growth of O. oeni strains, previous assays were carried out in the same MRS broth used in precultures of fermentation assays. There was a clear lower growth when succinic acid was present for both strains assayed (Supplementary Figure 1), and this effect was progressively significantly higher with increasing concentration from 0.5 g/L to 2 g/L of succinic acid. As seen, with 1 g/L of succinic acid, the maximum population reached was about 50 % (strain PSU-1) or 70 % (CH11) of the control, and with 2 g/L it was about 30 % for PSU-1 and a mere 20 % of the control for strain CH11.
2. Effect of succinic acid on malolactic fermentation
After the first experiments for comparing four different O. oeni strains, PSU-1 and CH11 were selected and used exclusively throughout the entire study since they were representative of the two behaviours observed in response to adding succinic acid. O. oeni CH11 showed a stronger inhibition of MLF in the presence of 2 g/L of succinic acid than strain PSU-1. This agrees with the above commented stronger growth inhibition of CH11 at 2 g/L of succinic acid added to the MRS medium. The other O. oeni strains VP41 and 1Pw13 showed similar behaviour to CH11 but with longer and slower MLF in all assays (Supplementary Figure 2). Control fermentations in WLM with strain PSU-1, at both pH 3.5 and 4.0, were completed in 120 h, and those with strain CH11 finished in 144 h (Figure 1). The bacterial population in the samples of these WLM fermentations was followed, but no increase was detected in any of them nor in controls (data not shown). It must be taken into account that growth is usually very difficult in the harsh conditions of WLM, similar to wine, with ethanol and low pH, as observed previously (Bordas et al., 2015; Jiang et al., 2018). Nonetheless, the inoculated population can survive and finish the MLF.
The results obtained in the presence of succinic acid varied depending on the pH and strains. Succinic acid inhibited the MLF of the two O. oeni strains at concentrations of 1 and 2 g/L at pH 3.5, whereas at pH 4 only the MLF with 2 g/L of succinic acid with O. oeni CH11 was inhibited in comparison to the control assay (0 g/L succinic acid). At pH 3.5 with 2 g/L of succinic acid, 43 % and 34 % of the L-malic acid was not consumed by CH11 and PSU-1, respectively, at the time that the control had exhausted all the L-malic acid. This shows that O. oeni CH11 was more sensitive to this concentration of succinic acid than PSU-1. The results with 1 and 2 g/L of succinic acid showed that the pH has a relevant influence on the MLF and the inhibitory effect of this organic acid. Meanwhile, at pH 3.5, succinic acid reduced the L-malic acid consumption rate in CH11 and PSU-1; however, at pH 4.0, both strains were able not only to carry out MLF but also to do so in less time than the control assay. Therefore, pH is an important factor because this physicochemical condition affects the dissociated and undissociated forms of succinic and malic acids, as observed by Augagneur et al. (2007).
Nevertheless, both strains CH11 and PSU-1 showed similar results in the 0.5 g/L succinic acid and in all cases, MLF finished about 24 h earlier than in the control assay. This best MLF performance in the presence of 0.5 g/L than without succinic acid was also found for the other two strains, 1Pw13 and VP41 (Supplementary Figure 1). Therefore, we have found that this low concentration of succinic acid could be slightly beneficial for O. oeni and the MLF, while levels of 1 g/L succinic acid or higher are clearly inhibitory. This probable benefit could be related to the above-commented decrease in succinic acid in some MLFs (Taniasuri et al., 2016; Yilmaz and Gökmen, 2021); however, we did not find significant variation in the succinic acid concentration in any case (data not shown).
Figure 1. L-malic consumption in WLM with 12 % ethanol (v/v) at pH 3.5 and 4.0 by O. oeni strains CH11 and PSU-1, in the presence of different concentrations of succinic acid: 0 g/L (control, blue), 0.5 g/L (red), 1 g/L (yellow), and 2 g/L (green). The values are the means of triplicates and the error bars represent the SD values.
Anyway, it is clear that MLF is inhibited by a concentration of 1 g/L or higher of succinic acid for both strains and pHs. This inhibition is probably related to intracellular acidification by this acid, which would lead to a decrease in cell viability, affecting, in consequence, the MLF. Although, as commented above, we had not detected variation—neither decrease nor decrease—in biomass in these assays with WLM, the inhibition effect on cell growth was clear in the previous assays with MRS medium.
Regarding the important role that pH played in the performance of the MLF with the two strains, the results obtained with 1 and 2 g/L of succinic acid could be related to the dissociated and undissociated forms of succinic and L-malic acids. At pH 3.5, L-malic acid would be present at almost 50 % in dissociated monoanionic form (L-malic acid pKa1 = 3.4) (Tourdot-Maréchal et al., 1993), whereas a large fraction of succinic acid (more than 70 %) is in its undissociated form (succinic acid pKa1 = 4.2) (Jansen and van Gulik, 2014). However, at pH 4.0, only around 50 % of succinic acid would be undissociated (Jansen and van Gulik, 2014). At pH values above 4.5, the passive diffusion of L-malic acid into O. oeni cells would be negligible (Tourdot-Maréchal et al. (1993). However, at pH 3.2, the permeability of the cells to the undissociated acid by simple diffusion could represent more than 50 % of the total L-malic acid uptake. Considering that succinic acid and L-malic acid have a very similar chemical structure, it would be feasible that undissociated succinic acid could enter the O. oeni cell at pH 3.5, producing intracellular acidification due to the complete deprotonation of succinic acid at the cytosolic pH (O. oeni intracellular pH = 5.8–6.1; succinic acid pka1 = 4.2 pka2 = 5.6). Internal acidification has been associated with the inhibition of MLF by other acidic compounds at pH values close to 3, such as octanoic acid and some phenolic acids (Capucho and San Romao, 1994; Campos et al., 2003). The cytosolic acidification is known to inhibit the enzymatic activities of O. oeni in general and it affects the viability of the cells, as commented. However, moreover, the malolactic activity could be specifically affected due to the changes in the L-malate anionic state inside the cell. According to Acevedo et al. (2020), the optimal substrate for the malolactic enzyme in O. oeni is dianionic L-malate, which is the form present at the standard intracellular O. oeni pH (5.8–6.1). The internal acidification produced by succinic acid could convert dianionic L-malate into the monoanionic form, negatively affecting the malolactic enzyme efficiency. Altogether, the internal acidification of O. oeni, favoured at a low pH, could explain the stronger inhibition of succinic acid at pH 3.5 than at pH 4 observed in this work.
In regard to the composition of organic acids after MLF, there were no differences in L-lactic acid production (data not shown) because it was in accordance with the L-malic acid consumption. In addition, the amounts of acetic acid in each treatment were in accordance with the citric acid consumption and no statistical differences were found (data not shown). Neither one was above the acetic acid threshold (0.7 g/L) (Drysdale and Fleet, 1989).
3. Influence of succinic acid on MLF at different ratios of L-malic and succinic acid
As seen above, the increasing amounts of succinic acid exerted an inhibition effect on the L-malic acid consumption. To understand this effect in more depth, we carried out assays in the same WLM with different ratios of L-malic and succinic acids. In addition, we aimed to determine whether there was an inhibition threshold of succinic acid depending on the initial L-malic acid concentration. At the same time, these assays simulated the real situation of the diversity of initial L-malic acid levels (from 0.5 to 3 g/L in these assays) in different climatic zones of winemaking.
To determine this influence, L-malic acid consumption rates were calculated for the different assays, shown in Supplementary Table 1. As seen, the main significant inhibition of succinic acid was when L-malic acid was 0.5 or 1 g/L. To visualise these results better, they are summarised in Figure 2.
There is a significantly bigger inhibition of the consumption rate for most conditions when 2 g/L of succinic acid is present, in agreement with the inhibition of MLF kinetics we found and discussed above. In terms of the pH, a slightly greater L-malic acid consumption can be observed at pH 4.0 than at 3.5, as expected since the higher pH is less stressful for O. oeni. The consumption tendencies are similar for both the strains and the succinic concentrations for the two pHs (Figure 2).
Figure 2. L-malic acid consumption rate (mg/L·h) by O. oeni strains CH11 and PSU-1 in WLM with 12 % ethanol (v/v) at pH 3.5 and 4.0 with L-malic acid (0.5 g/L [black], and 1 g/L [grey]), at different concentrations of succinic acid. a–c Values of columns for each strain and pH are significantly different at p ≤ 0.05 according to the Tukey test.
The most relevant result here is that there is generally more inhibition of the consumption rate at 0.5 g/L of L-malic acid than at 1 g/L, which is clearer for strain CH11 (Figure 2). It seems that succinic acid has an inhibiting effect on the consumption rate of L-malic acid when this is in a lower ratio with respect to succinic acid. That is, succinic acid has a clear inhibition effect on MLF when the concentration of this acid is higher than that of L-malic acid. In addition to the inhibition of MLF due to the already mentioned intracellular acidification caused by succinic acid, there could be competition between the succinic and L-malic acids for the malolactic enzyme due to their similar chemical structures, as suggested by Lonvaud-Funel and Strasser de Saad (1982).
It is particularly important to take this effect into account nowadays, when it is usual to have a low L-malic acid content in wine, mainly due to climate change that leads to less acidic grapes (Mira de Orduña, 2010).
4. The effect of succinic acid on the consumption of L-malic acid by resting cells
Unlike the WLM, where O. oeni can grow, the resting cell buffer provides a way to monitor the malolactic enzymatic activity without interference from nutrients and metabolic changes related to growth. Therefore, in resting cell assays, there is no adaptation phase of growing cells and the effect of succinic is more direct. Cells number was about 5·109/mL as they were harvested from 250 mL at the early stationary phase (109/mL) and resuspended to a final volume of 50 mL, as said in Methods.
The consumption of 2 g/L (14.9 mM) of L-malic acid by resting cells was very quick (around 80–120 min) for both strains and pH levels and at the different succinic acid concentrations (data not shown). Hence, the high number of resting cells present can consume L-malic rapidly. These short times are similar to those found in similar works (Mira de Orduña et al., 2000).
To compare the L-malic acid consumption rate under the different conditions, we considered the amount of L-malic acid for assays with different succinic acid concentrations at the time when control assays had consumed about half of the L-malic acid (Table 2). This middle point of MLF (i.e., about 1 g/L (7.5 mM)) was at about 20 min for the control without succinic acid. Similarly, the data shown are for other sample conditions also taken at about 20 min. The different values of L-malic acid shown for the control at mid-MLF (from 2.08 to 6.82 mM) can be explained because samples were taken every 20 min and the L-malic consumption was very quick. Therefore, these are approximative values for mid-MLF.
We can observe (Table 2) that for most conditions, when succinic is present, the remaining L-malic acid is significantly higher than the control. Hence, succinic acid slows down the consumption of L-malic acid. Nevertheless, when succinic acid is 3.7 mM (0.5 g/L), the quantity of L-malic acid is significantly lower than the control at mid-MLF, indicating a quicker consumption rate at the lowest concentration of succinic acid. This tendency was not shown for PSU-1 at pH 4.2.
Table 2. L-malic acid amount (mM) for different succinic acid concentrations of the assays with resting cells, when control assay (0 mM succinic acid) has consumed about half of L-malic, id est, at middle MLF.
pH |
Succinic acid (mM) |
CH11 |
PSU-1 |
|
|---|---|---|---|---|
3.5 |
0 |
2.08 ± 0.226 bc |
6.82 ± 0.197 d |
|
3.7 |
0.29 ± 0.185 d |
4.59 ± 0.161 e |
||
7.4 |
1.54 ± 0.185 c |
8.05 ± 0.161 c |
||
14.9 |
2.71 ± 0.185 b |
9.00 ± 0.161 b |
||
29.8 |
4.55 ± 0.185 a |
10.74 ± 0.161 a |
||
4.2 |
0 |
4.28 ± 0.583 cd |
3.73 ± 0.248 d |
|
3.7 |
1.98 ± 0.476 d |
5.24 ± 0.203 c |
||
7.4 |
5.54 ± 0.476 bc |
8.67± 0.203 ab |
||
14.9 |
7.01 ± 0.476 ab |
8.97 ± 0.203 a |
||
29.8 |
8.57 ± 0.476 a |
9.30 ± 0.203 b |
a–e Values for different succinic acid concentrations for the same pH and strain are significantly different at p ≤ 0.05, according to the Tukey test.
Overall, these results agree with those obtained previously in WLM (Figure 2), where the succinic acid inhibition of MLF was higher for concentrations higher than 1 g/L, that is, more than 7.4 mM of succinic acid.
5. Relative expression of genes related to stress and malolactic activity
To evaluate the possible inhibition of succinic acid in relation to the transcription of relevant genes associated with MLF development, we measured the relative expression of the following genes: i) mleA, encoding the malolactic enzyme, and mleP, encoding the L-malic acid transporter; ii) atpB, encoding the β-subunit of the F1F0 ATPase, associated with MLF activity and acid stress response (Cox and Henick-Kling, 1989; Fortier et al., 2003) and iii) hsp18, encoding for one of the most relevant stress proteins of O. oeni with a chaperone function, this gene is known to be activated in response to multiple stresses and has been proposed to be a stress adaptation indicator (Coucheney et al., 2005; Beltramo et al., 2006). The analysis was carried out with samples from the assay performed in WLM with the most inhibitory concentration of succinic acid (2 g/L). All samples were taken when the L-malic acid concentration was approximately 1 g/L in each case, at mid-MLF. Samples from cultures without added succinic acid were also analysed as control conditions.
In O. oeni CH11, the strain that showed the highest sensitivity to succinic acid, the gene hsp18 was clearly up-regulated at pH 3.5 and 4.0 (Figure 3). In contrast, the PSU-1 strain did not show overexpression of the hsp18 gene in any of the assayed conditions. These data suggest that the CH11 strain adopted this strategy to outcome the succinic acid inhibitory effect. However, O. oeni PSU-1, the strain least affected by succinic acid, might respond to stress differently, as seen in previous studies (Olguín et al. 2010).
No changes in expression were observed for atpB in any of the conditions studied. The transient activation of this gene has been described in response to acid shock (Fortier et al., 2003). In this study, there was no difference in the transcriptional levels of atpB at mid-MLF with or without succinic acid.
Surprisingly, O. oeni PSU-1 showed a 3.5 and 2.5-fold up-regulation of the genes mleP and mleA at pH 4 (Figure 3). This could be related to the faster MLF observed under these conditions (2 g/L succinic acid) with respect to the control condition at the same pH. However, the reason for the enhanced MLF due to the presence of succinic acid remains unclear and needs further research.
The main conclusion of the transcriptional study is that succinic acid does not inhibit the transcription of the mleA and mleP genes in any of the conditions. Therefore, the inhibition of MLF caused by this compound might be due to the intracellular acidification and possible substrate competition with L-malic acid at the enzymatic level, as previously discussed.
Figure 3. Relative expression (RE) of four genes related to stress (hsp18 and atpB) and malolactic activity (mleP and mleA) of strains CH11 and PSU-1 of O. oeni at middle MLF (approx. 1 g/L L-malic acid) in the presence of 2 g/L of succinic acid. The calibrator condition (RE = 1) was the absence of succinic acid. The data shown are mean values between both RE obtained with gene controls gyrA and gyrB with error bars representing SD values (n = 3).
Conclusion
In this work, the effect of succinic acid on O. oeni and MLF has been evaluated for the first time. It shows that succinic acid can inhibit MLF at concentrations higher than 1 g/L, but it could be beneficial at a lower concentration, near 0.5 g/L. The inhibition is clear when L-malic acid is at a lower ratio with respect to succinic acid. As succinic acid is produced by yeasts, including non-Saccharomyces species, this variable effect is an example of an interaction between yeasts and LAB that can be negative or positive depending on the succinic concentration but also on the strains and other winemaking conditions. Therefore, one of the most important factors is the pH because this physicochemical condition influences the dissociated and undissociated forms of both acids. Consequently, the strain-dependent effect can lead to inhibition or promotion of MLF due to the cell response and adaptation. Further research is necessary to understand the molecular mechanisms of the influence of succinic acid on O. oeni and possibly the competence of succinic acid against L-malic acid at the enzymatic and transport levels.
Acknowledgements
This work was supported by grants AGL2015-70378-R and PGC2018-101852-B-I00, funded by Spanish MCIN/AEI/10.13039/501100011033 and, when appropriate, by ERDF "A way of making Europe", by the European Union or by the European Union Next Generation EU/PRTR. RT-G is grateful for the predoctoral fellowship from Fundación Carolina, which includes a partial stipend from the Mexican Government and University Rovira i Virgili.
References
- Acevedo, W., Cañón, P., Gómez-Alvear, F., Huerta, J., Aguayo, D., & Agosin, E. (2020). L-Malate (−2) protonation state is required for efficient decarboxylation to L-lactate by the malolactic enzyme of Oenococcus oeni. Molecules, 25, 3431. https://doi.org/10.3390/molecules25153431
- Arikawa, Y., Kuroyanagi, T., Shimosaka, M., Muratsubaki, H., Enomoto, K., Kodaira, R., & Okazaki, M. (1999). Effect of gene disruptions of the TCA cycle on production of succinic acid in Saccharomyces cerevisiae. Journal of Bioscience and Bioengineering, 87, 28-36. https://doi.org/10.1016/S1389-1723(99)80004-8
- Arnink, K., & Henick-Kling, T. (2005). Influence of Saccharomyces cerevisiae and Oenococcus oeni strains on successful malolactic conversion in wine. American Journal of Enology and Viticulture, 56, 228-237. https://www.ajevonline.org/content/56/3/228.short
- Augagneur, Y., Ritt, J. F., Linares, D. M., Remize, F., Tourdot-Maréchal, R., Garmyn, D., & Guzzo, J. (2007). Dual effect of organic acids as a function of external pH in Oenococcus oeni. Archives of Microbiology, 188(2), 147–157. https://doi.org/10.1007/s00203-007-0230-0
- Balmaseda, A., Bordons, A., Reguant, C., & Bautista-Gallego, J. (2018). Non-Saccharomyces in wine: Effect upon Oenococcus oeni and malolactic fermentation. Frontiers in Microbiology 9, 534, 1-8. https://doi.org/10.3389/fmicb.2018.00534
- Balmaseda, A., Rozès, N., Leal, M. A., Bordons, A., & Reguant, C. (2021). Impact of changes in wine composition produced by non-Saccharomyces on malolactic fermentation. International Journal of Food Microbiology, 337, 108954. https://doi.org/10.1016/j.ijfoodmicro.2020.108954
- Bartowsky, E.J. (2005). Oenococcus oeni and malolactic fermentation—Moving into the molecular arena. Australian Journal of Grape and Wine Research, 11, 174–187. https://doi.org/10.1111/j.1755-0238.2005.tb00286.x
- Belda, I., Ruiz, J., Esteban-Fernández, A., Navascués, E., Marquina, D., Santos, A., & Moreno-Arribas, M. V. (2017). Microbial contribution to wine aroma and its intended use for wine quality improvement. Molecules 22, 1–29. https://doi.org/10.3390/ molecules22020189
- Beltramo, C., Desroche, N., Tourdot-Maréchal, R., Grandvalet, C., & Guzzo, J. (2006). Real-time PCR for characterizing the stress response of Oenococcus oeni in a wine-like medium. Research in Microbiology, 157(3), 267–274. https://doi.org/10.1016/j.resmic.2005.07.006
- Bordas, M., Araque, I., Alegret, J. O., El Khoury, M., Lucas, P., Rozès, N., Reguant, C., & Bordons, A. (2013). Isolation, selection, and characterisation of highly ethanol-tolerant strains of Oenococcus oeni from south Catalonia. International Microbiology, 16(2), 113–123. https://doi.org/10.2436/20.1501.01.186
- Bordas, M., Araque, I., Bordons, A., & Reguant, C. (2015). Differential expression of selected Oenococcus oeni genes for adaptation in wine-like media and red wine. Annals of Microbiology 65 (4), 2277-2285. http://dx.doi.org/10.1007/s13213-015-1069-2
- Branco, P., Francisco, D., Chambon, C., Hébraud, M., Arneborg, N., Almeida, M. G., Caldeira, J., & Albergaria, H. (2014). Identification of novel GAPDH-derived antimicrobial peptides secreted by Saccharomyces cerevisiae and involved in wine microbial interactions. Applied Microbiology and Biotechnology, 98(2), 843–853. https://doi.org/10.1007/s00253-013-5411-y
- Campos, F. M., Couto, J. A., & Hogg, T. A. (2003). Influence of phenolic acids on growth and inactivation of Oenococcus oeni and Lactobacillus hilgardii. Journal of Applied Microbiology, 94(2):167-74. https://doi.org/10.1046/j.1365-2672.2003.01801.x
- Capucho, I., & San Romao, M.V. (1994). Effect of ethanol and fatty acids on malolactic activity of Leuconostoc oenos. Applied Microbiology and Biotechnology, 42, 391-395.
- Caridi, A., & Corte, V. (1997). Inhibition of malolactic fermentation by cryotolerant yeasts. Biotechnology Letters 19, 723–726. https://doi.org/10.1023/A:1018319705617
- ChemIDplus (2021). US National Library of Medicine databases of chemical substances. https://chem.nlm.nih.gov/chemidplus/name/succinic%20acid
- Chomczynski, P., & Sacchi, N. (2006). The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: Twenty-something years on. Nature Protocols, 1(2), 581–585. https://doi.org/10.1038/nprot.2006.83
- Ciani, M., & Maccarelli, F. (1998). Oenological properties of non-Saccharomyces yeasts associated with wine-making. World Journal of Microbiology and Biotechnology 14, 199–203. https://doi.org/10.1023/A:1008825928354
- Contreras, A., Hidalgo, C., Henschke, P. A., Chambers, P. J., Curtin, C., & Varela, C. (2014). Evaluation of Non-Saccharomyces Yeasts for the Reduction of Alcohol Content in Wine. Applied and Environmental Microbiology, 80(5), 1670–1678. https://doi.org/10.1128/AEM.03780-13
- Conway, E. J., & Brady, T. G. (1950). Biological Production of acid and alkali. 1. Quantitative relations of succinic and carbonic acids to the potassium and hydrogen ion exchange in fermenting yeast. Biochemical Journal, 47, 360-369. https://doi.org/10.1042/bj0470360
- Coulter, A. D., Godden, P. W., & Pretorius, I. S. (2004). Succinic acid-how it is formed, what is its effect on titratable acidity, and what factors influence its concentration in wine. Australian and New Zealand Wine Industry Journal, 19(6), 16-20.
- Coucheney, F., Desroche, F., Bou, M., Tourdot-Maréchal, R., Dulau, L., & Guzzo, J. (2005). A new approach for selection of Oenococcus oeni strains in order to produce malolactic starters. International Journal of Food Microbiology, 105 (3), 463-470. https://doi.org/10.1016/j.ijfoodmicro.2005.04.023.
- Cox, D. J., & Henick-Kling, T. (1989). Proton-motive force and ATP generation during malolactic fermentation. American Journal of Enology and Viticulture, 46, 319-323. https://www.ajevonline.org/content/46/3/319
- De Klerk, J. L. (2010). Succinic acid production by wine yeasts. Thesis, Master of Agricultural Sciences, Stellenbosch University, South Africa. http://hdl.handle.net/10019.1/4228
- Desroche, N., Beltramo, C., & Guzzo, J. (2005). Determination of an internal control to apply reverse transcription quantitative PCR to study stress response in the lactic acid bacterium Oenococcus oeni. Journal of Microbiological Methods, 60(3), 325–333. https://doi.org/10.1016/j.mimet.2004.10.010
- Drysdale, G., & Fleet, G. (1989). The effect of acetic acid bacteria upon the growth and metabolism of yeast during the fermentation of grape juice. Journal of Applied Bacteriology, 67, 471-481. https://doi-org/10.1111/j.1365-2672.1989.tb02518.x
- Ferrando, N., Araque, I., Ortís, A., Thornes, G., Bautista-Gallego, J., Bordons, A., & Reguant, C. (2020). Evaluating the effect of using non-Saccharomyces on Oenococcus oeni and wine malolactic fermentation. Food Research International, 138 B, 109779. https://doi.org/10.1016/j.foodres.2020.109779
- Fleet, G. H., Lafon-Lafourcade, S., & Ribereau-Gayon, P. (1984). Evolution of yeasts and lactic acid bacteria during fermentation and storage of Bordeaux wines. Applied and Environmental Microbiology, 48, 1034-1038. https://doi-org/10.1128/aem.48.5.1034-1038.1984
- Fortier, L-C., Tourdot-Maréchal, R., Diviès, C., Lee, B. H., & Guzzo, J. (2003). Induction of Oenococcus oeni H+-ATPase activity and mRNA transcription under acidic conditions, FEMS Microbiology Letters, 222 (2), 165–169. https://doi.org/10.1016/S0378-1097(03)00299-4
- Guilloux-Benatier, M., Le Fur, Y., & Feuillat, M. (1998). Influence of fatty acids on the growth of wine microorganisms Saccharomyces cerevisiae and Oenococcus oeni. Journal of Industrial Microbiology and Biotechnology, 20(3–4), 144–149. https://doi.org/10.1038/sj.jim.2900502
- Heerde, E., & Radler, F. (1978). Metabolism of the anaerobic formation of succinic acid by Saccharomyces cerevisiae. Archives of Microbiology, 117, 269–276. https://doi.org/10.1007/BF00738546
- Jansen, M. L. A., & van Gulik, W. M. (2014). Towards large scale fermentative production of succinic acid. Current Opinion in Biotechnology, 30, 190-197. http://dx.doi.org/10.1016/j.copbio.2014.07.003
- Jiang, J., Sumby, K. M., Sundstrom, J. F., Grbin, P. R., & Jiranek, V. (2018). Directed evolution of Oenococcus oeni strains for more efficient malolactic fermentation in a multi-stressor wine environment. Food Microbiology, 73, 150-159. https://doi.org/10.1016/j.fm.2018.01.005
- Lamikanra, O. (1997). Changes in organic acid composition during fermentation and agin of noble muscadine wine. Journal of Agricultural and Food Chemistry, 45, 935-937. https://doi.org/10.1021/jf960447k
- Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262
- Lonvaud-Funel, A., & Strasser de Saad, A. (1982). Purification and properties of a malolactic enzyme from a strain of Leuconostoc mesenteroides isolated from grapes. Applied and Environmental Microbiology, 43(2), 357–361. https://doi.org/10.1128/aem.43.2.357-361.1982
- Lonvaud‐Funel, A., Joyeux, A., & Desens, C. (1988). Inhibition of malolactic fermentation of wines by products of yeast metabolism. Journal of the Science of Food and Agriculture, 44(2), 183–191. https://doi.org/10.1002/jsfa.2740440209
- Lonvaud-Funel, A. (1999). Lactic acid bacteria in the quality improvement and depreciation of wine. In: Konings W. N., Kuipers O. P., & In ’t Veld, J. H. J. H. (eds) Lactic Acid Bacteria: Genetics, Metabolism and Applications. Springer, Dordrecht. https://doi.org/10.1007/978-94-017-2027
- Mendes-Ferreira, A., & Mendes-Faia, A. (2020). The Role of Yeasts and Lactic Acid Bacteria on the Metabolism of Organic Acids during Winemaking. Foods, 9, 1231. https://doi.org/10.3390/foods9091231
- Mira de Orduña, R. (2010). Climate change associated effects on grape and wine quality and production. Food Research International, 43, 7, 1844-1855. https://doi.org/10.1016/j.foodres.2010.05.001.
- Mira de Orduña, R., Liu, S. Q., Patchett, M. L., & Pilone, G. J. (2000). Ethyl carbamate precursor citrulline formation from arginine degradation by malolactic wine lactic acid bacteria. FEMS Microbiology Letters, 183(1), 31–35. https://doi.org/10.1016/S0378-1097(99)00624-2
- Olguín, N., Bordons, A., & Reguant, C. (2010). Multigenic expression analysis as an approach to understanding the behaviour of Oenococcus oeni in wine-like conditions. International Journal of Food Microbiology, 144(1), 88–95. https://doi.org/10.1016/j.ijfoodmicro.2010.08.032
- Osborne, J. P., & Edwards, C. G. (2007). Inhibition of malolactic fermentation by a peptide produced by Saccharomyces cerevisiae during alcoholic fermentation. International Journal of Food Microbiology, 118(1), 27–34. https://doi.org/10.1016/j.ijfoodmicro.2007.05.007
- Padilla, B., Gil, J. V., & Manzanares, P. (2016). Past and future of non-Saccharomyces yeasts: from spoilage microorganisms to biotechnological tools for improving wine aroma complexity. Frontiers in Microbiology 7, 411. https://doi.org/10.3389/fmicb.2016.00411
- Son, H. S., Hwang, G. S., Park, W. M., Hong, Y. S., & Lee, C. H. (2009). Metabolomic characterisation of malolactic fermentation and fermentative behaviors of wine yeasts in grape wine. Journal of Agricultural and Food Chemistry, 57, 4801–4809. https://doi.org/10.1021/jf9005017
- Taniasuri, F., Lee, P. R., & Liu, S. Q. (2016). Induction of simultaneous and sequential malolactic fermentation in durian wine. International Journal of Food Microbiology, 230, 1-9. https://doi.org/10.1016/j.ijfoodmicro.2016.04.006
- Thoukis, G. M., Ueda, M., & Wright, D. (1965). The formation of succinic acid during alcoholic fermentation. American Journal of Enology and Viticulture, 16, 1-8. https://www.ajevonline.org/content/16/1/1.short
- Tourdot-Maréchal, R., Cavin, J., & Drici-Cachon, Z. (1993). Transport of malic acid in Leuconostoc oenos strains defective in malolactic fermentation: A Model To Evaluate the Kinetic Parameters. Applied Microbiology, 5, 499–505. https://doi.org/10.1007/BF00205040
- Yilmaz, C., & Gökmen, V. (2021). Formation of amino acid derivatives in white and red wines during fermentation: Effects of non-Saccharomyces yeasts and Oenococcus oeni. Food Chemistry, 343, 128415. https://doi.org/10.1016/j.foodchem.2020.128415
- Zhu, X., Navarro, Y., Mas, A., Torija, M. J., & Beltran, G. (2020). A rapid method for selecting non-Saccharomyces strains with a low ethanol yield. Microorganisms, 8(5). https://doi.org/10.3390/microorganisms8050658

Views: 3128
XML: 138